Incidental Mutation 'R7490:Rasa2'
ID580688
Institutional Source Beutler Lab
Gene Symbol Rasa2
Ensembl Gene ENSMUSG00000032413
Gene NameRAS p21 protein activator 2
SynonymsGAP1m, 5430433H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location96539300-96631617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96566122 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 494 (N494S)
Ref Sequence ENSEMBL: ENSMUSP00000034984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034984
AA Change: N494S

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413
AA Change: N494S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
C2 38 136 3.78e-16 SMART
C2 171 287 8.48e-19 SMART
RasGAP 300 641 7.05e-140 SMART
PH 604 706 1.98e-17 SMART
BTK 706 742 1.39e-18 SMART
low complexity region 824 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128346
SMART Domains Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413

DomainStartEndE-ValueType
C2 3 79 6.86e-5 SMART
C2 114 230 8.48e-19 SMART
RasGAP 243 584 7.05e-140 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Rasa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Rasa2 APN 9 96544860 missense probably damaging 1.00
IGL00661:Rasa2 APN 9 96577553 splice site probably benign
IGL00825:Rasa2 APN 9 96570719 missense probably benign 0.37
IGL01645:Rasa2 APN 9 96582781 nonsense probably null
IGL02260:Rasa2 APN 9 96544319 missense probably benign 0.08
IGL02568:Rasa2 APN 9 96580510 missense probably damaging 1.00
IGL02963:Rasa2 APN 9 96570785 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0144:Rasa2 UTSW 9 96592019 missense probably damaging 0.99
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0295:Rasa2 UTSW 9 96545810 splice site probably null
R0332:Rasa2 UTSW 9 96606176 missense probably damaging 1.00
R0348:Rasa2 UTSW 9 96571959 missense probably damaging 1.00
R0931:Rasa2 UTSW 9 96552404 missense possibly damaging 0.88
R1067:Rasa2 UTSW 9 96552323 missense probably damaging 1.00
R1485:Rasa2 UTSW 9 96544348 missense probably benign 0.00
R1562:Rasa2 UTSW 9 96545750 missense possibly damaging 0.89
R1698:Rasa2 UTSW 9 96568375 missense possibly damaging 0.56
R1980:Rasa2 UTSW 9 96570768 missense probably damaging 0.99
R3055:Rasa2 UTSW 9 96611473 missense possibly damaging 0.77
R4175:Rasa2 UTSW 9 96560777 missense probably benign 0.01
R4258:Rasa2 UTSW 9 96557380 intron probably benign
R4432:Rasa2 UTSW 9 96542407 unclassified probably benign
R4636:Rasa2 UTSW 9 96544337 missense probably benign
R4773:Rasa2 UTSW 9 96544417 missense probably benign
R4990:Rasa2 UTSW 9 96591989 missense probably benign 0.24
R5177:Rasa2 UTSW 9 96544791 nonsense probably null
R5462:Rasa2 UTSW 9 96571918 missense probably damaging 1.00
R5737:Rasa2 UTSW 9 96570665 critical splice donor site probably null
R5775:Rasa2 UTSW 9 96577468 splice site probably null
R5866:Rasa2 UTSW 9 96545770 missense probably benign 0.00
R5938:Rasa2 UTSW 9 96611389 missense possibly damaging 0.50
R6076:Rasa2 UTSW 9 96545646 missense probably benign
R6216:Rasa2 UTSW 9 96544304 missense probably damaging 1.00
R6743:Rasa2 UTSW 9 96611440 missense probably damaging 1.00
R6982:Rasa2 UTSW 9 96560750 missense probably damaging 1.00
R7350:Rasa2 UTSW 9 96544355 missense probably benign 0.16
R7405:Rasa2 UTSW 9 96566027 missense probably benign 0.09
R7421:Rasa2 UTSW 9 96611447 missense unknown
R7515:Rasa2 UTSW 9 96552300 splice site probably null
R7547:Rasa2 UTSW 9 96611421 missense probably damaging 1.00
R7557:Rasa2 UTSW 9 96557425 missense probably damaging 0.98
R7894:Rasa2 UTSW 9 96602727 missense probably benign 0.13
R7977:Rasa2 UTSW 9 96602727 missense probably benign 0.13
RF017:Rasa2 UTSW 9 96631468 small insertion probably benign
RF029:Rasa2 UTSW 9 96631467 small insertion probably benign
RF047:Rasa2 UTSW 9 96631467 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAACTGTGAAATGTCTTATCAC -3'
(R):5'- GTACTACGTAGGGCTTTAATGTTAC -3'

Sequencing Primer
(F):5'- GTGAAATGTCTTATCACCGAAAAAG -3'
(R):5'- TTCACAGCTCAGTTTTTACA -3'
Posted On2019-10-17