Incidental Mutation 'R7490:Dnmt3a'
Institutional Source Beutler Lab
Gene Symbol Dnmt3a
Ensembl Gene ENSMUSG00000020661
Gene NameDNA methyltransferase 3A
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location3806007-3914443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 3904204 bp
Amino Acid Change Glycine to Aspartic acid at position 792 (G792D)
Ref Sequence ENSEMBL: ENSMUSP00000020991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020991] [ENSMUST00000111186] [ENSMUST00000172689] [ENSMUST00000172913] [ENSMUST00000174483] [ENSMUST00000174817]
Predicted Effect probably damaging
Transcript: ENSMUST00000020991
AA Change: G792D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020991
Gene: ENSMUSG00000020661
AA Change: G792D

low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111186
AA Change: G573D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106817
Gene: ENSMUSG00000020661
AA Change: G573D

PWWP 67 125 1.36e-24 SMART
low complexity region 193 211 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
PDB:3A1B|A 235 391 1e-101 PDB
Blast:RING 314 363 4e-16 BLAST
Pfam:DNA_methylase 411 554 9.5e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172689
AA Change: G573D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133543
Gene: ENSMUSG00000020661
AA Change: G573D

PWWP 67 125 1.36e-24 SMART
low complexity region 193 211 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
PDB:3A1B|A 235 391 1e-101 PDB
Blast:RING 314 363 4e-16 BLAST
Pfam:DNA_methylase 411 554 9.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172913
SMART Domains Protein: ENSMUSP00000134496
Gene: ENSMUSG00000020661

PDB:2QRV|H 1 69 3e-46 PDB
SCOP:d6mhta_ 2 66 6e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174483
SMART Domains Protein: ENSMUSP00000133938
Gene: ENSMUSG00000020661

low complexity region 35 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174733
SMART Domains Protein: ENSMUSP00000134492
Gene: ENSMUSG00000020661

Pfam:DNA_methylase 16 104 8.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174817
AA Change: G792D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134009
Gene: ENSMUSG00000020661
AA Change: G792D

low complexity region 2 13 N/A INTRINSIC
low complexity region 15 37 N/A INTRINSIC
internal_repeat_1 55 101 6.44e-5 PROSPERO
low complexity region 109 124 N/A INTRINSIC
low complexity region 160 177 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
internal_repeat_1 241 283 6.44e-5 PROSPERO
PWWP 286 344 1.36e-24 SMART
low complexity region 412 430 N/A INTRINSIC
low complexity region 438 453 N/A INTRINSIC
PDB:3A1B|A 454 610 2e-99 PDB
Blast:RING 533 582 1e-17 BLAST
Pfam:DNA_methylase 630 772 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of two related genes encoding de novo DNA methyltransferases, which are responsible for the establishment of DNA methylation patterns in embryos. Loss of function of this gene causes developmental defects in multiple different organ systems. There is a pseudogene for this gene located on chromosome 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for a targeted null mutation become runted and die around four weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Dnmt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Dnmt3a APN 12 3905622 missense probably damaging 1.00
IGL02255:Dnmt3a APN 12 3872886 splice site probably benign
IGL02815:Dnmt3a APN 12 3904226 critical splice donor site probably null
IGL03372:Dnmt3a APN 12 3902666 missense probably damaging 1.00
R0028:Dnmt3a UTSW 12 3900337 missense probably damaging 0.99
R0306:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R0843:Dnmt3a UTSW 12 3872886 splice site probably benign
R1055:Dnmt3a UTSW 12 3872864 missense probably benign 0.05
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1465:Dnmt3a UTSW 12 3866088 missense probably damaging 1.00
R1585:Dnmt3a UTSW 12 3901660 missense probably damaging 0.99
R1680:Dnmt3a UTSW 12 3873361 missense probably damaging 0.97
R1753:Dnmt3a UTSW 12 3873342 missense possibly damaging 0.54
R2055:Dnmt3a UTSW 12 3872859 missense probably benign 0.44
R2219:Dnmt3a UTSW 12 3849654 utr 5 prime probably benign
R2267:Dnmt3a UTSW 12 3897551 splice site probably null
R2359:Dnmt3a UTSW 12 3901599 missense probably damaging 1.00
R2384:Dnmt3a UTSW 12 3901591 missense probably damaging 1.00
R2403:Dnmt3a UTSW 12 3899883 missense probably damaging 1.00
R2884:Dnmt3a UTSW 12 3896132 missense probably damaging 1.00
R3027:Dnmt3a UTSW 12 3849626 splice site probably null
R4281:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4282:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4283:Dnmt3a UTSW 12 3901665 missense probably damaging 1.00
R4809:Dnmt3a UTSW 12 3900352 missense probably damaging 1.00
R5154:Dnmt3a UTSW 12 3896008 missense probably damaging 1.00
R5361:Dnmt3a UTSW 12 3895643 missense probably benign 0.13
R5483:Dnmt3a UTSW 12 3899615 missense probably damaging 1.00
R5768:Dnmt3a UTSW 12 3885660 splice site probably null
R5928:Dnmt3a UTSW 12 3866096 missense possibly damaging 0.69
R6432:Dnmt3a UTSW 12 3902399 missense probably damaging 0.99
R6552:Dnmt3a UTSW 12 3907623 missense probably damaging 1.00
R6783:Dnmt3a UTSW 12 3897406 missense probably damaging 0.99
R6850:Dnmt3a UTSW 12 3897600 missense probably benign 0.40
R7106:Dnmt3a UTSW 12 3897591 missense probably damaging 0.99
R7145:Dnmt3a UTSW 12 3872844 missense probably benign 0.01
R7149:Dnmt3a UTSW 12 3902397 missense probably damaging 1.00
R7239:Dnmt3a UTSW 12 3872850 missense probably benign 0.01
R7588:Dnmt3a UTSW 12 3896080 missense possibly damaging 0.91
R7684:Dnmt3a UTSW 12 3897340 missense probably benign 0.02
R8058:Dnmt3a UTSW 12 3902768 missense possibly damaging 0.92
R8316:Dnmt3a UTSW 12 3896965 missense probably benign 0.00
R8345:Dnmt3a UTSW 12 3835234 missense unknown
R8464:Dnmt3a UTSW 12 3899635 missense probably benign 0.03
Z1176:Dnmt3a UTSW 12 3904201 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-10-17