Incidental Mutation 'R7490:Dnaaf2'
ID580697
Institutional Source Beutler Lab
Gene Symbol Dnaaf2
Ensembl Gene ENSMUSG00000020973
Gene Namedynein, axonemal assembly factor 2
Synonyms2810020C19Rik, kintoun, Ktu, 1110034A24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location69189087-69198429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69197606 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 227 (Y227C)
Ref Sequence ENSEMBL: ENSMUSP00000021356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021356] [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
Predicted Effect probably damaging
Transcript: ENSMUST00000021356
AA Change: Y227C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021356
Gene: ENSMUSG00000020973
AA Change: Y227C

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
Pfam:PIH1 43 352 2e-99 PFAM
low complexity region 360 373 N/A INTRINSIC
SCOP:d1keka4 398 460 4e-3 SMART
low complexity region 672 693 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021359
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Predicted Effect probably benign
Transcript: ENSMUST00000223192
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a highly conserved protein involved in the preassembly of dynein arm complexes which power cilia. These complexes are found in some cilia and are assembled in the cytoplasm prior to transport for cilia formation. Mutations in the human gene have been associated with primary ciliary dyskinesia. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, reduced body size, situs inversus totalis, hydroencephaly and abnormal brain ependymal and tracheal cilia morphology and motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Dnaaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Dnaaf2 APN 12 69196766 missense probably benign 0.23
IGL01321:Dnaaf2 APN 12 69196602 missense probably damaging 1.00
IGL01880:Dnaaf2 APN 12 69190037 missense probably benign 0.17
R0329:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R0330:Dnaaf2 UTSW 12 69197744 missense probably damaging 1.00
R1051:Dnaaf2 UTSW 12 69197795 missense probably damaging 1.00
R1668:Dnaaf2 UTSW 12 69196691 missense probably benign 0.04
R2011:Dnaaf2 UTSW 12 69196785 missense probably damaging 1.00
R2179:Dnaaf2 UTSW 12 69198297 unclassified probably benign
R2243:Dnaaf2 UTSW 12 69196644 missense possibly damaging 0.83
R2356:Dnaaf2 UTSW 12 69198218 missense probably benign 0.01
R4120:Dnaaf2 UTSW 12 69198038 missense possibly damaging 0.85
R5086:Dnaaf2 UTSW 12 69197286 missense probably damaging 1.00
R5205:Dnaaf2 UTSW 12 69192924 missense probably damaging 1.00
R5300:Dnaaf2 UTSW 12 69198228 missense probably damaging 0.99
R5399:Dnaaf2 UTSW 12 69196742 missense probably damaging 0.97
R5739:Dnaaf2 UTSW 12 69196941 missense probably benign
R5765:Dnaaf2 UTSW 12 69192853 missense probably damaging 1.00
R5872:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6043:Dnaaf2 UTSW 12 69197348 missense probably damaging 1.00
R6338:Dnaaf2 UTSW 12 69198122 missense probably damaging 1.00
R6503:Dnaaf2 UTSW 12 69197511 missense probably benign 0.42
R6524:Dnaaf2 UTSW 12 69190385 missense probably benign 0.43
R6895:Dnaaf2 UTSW 12 69197663 missense probably benign 0.04
Z1176:Dnaaf2 UTSW 12 69197850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCGAGTCCAGGCACAG -3'
(R):5'- TGCAGCAACTCACTGGTAGG -3'

Sequencing Primer
(F):5'- AGTCCAGGCACAGCAGCTTC -3'
(R):5'- AGCAACTCACTGGTAGGCGTAC -3'
Posted On2019-10-17