Incidental Mutation 'R7490:Serpinb6c'
ID580700
Institutional Source Beutler Lab
Gene Symbol Serpinb6c
Ensembl Gene ENSMUSG00000052180
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6c
SynonymsSpi3C, SPIC, ovalbumin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location33879816-33905708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33893835 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 184 (D184V)
Ref Sequence ENSEMBL: ENSMUSP00000127619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110273] [ENSMUST00000172184] [ENSMUST00000222216]
Predicted Effect probably benign
Transcript: ENSMUST00000110273
AA Change: D184V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105902
Gene: ENSMUSG00000052180
AA Change: D184V

DomainStartEndE-ValueType
SERPIN 13 378 7.5e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172184
AA Change: D184V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127619
Gene: ENSMUSG00000052180
AA Change: D184V

DomainStartEndE-ValueType
SERPIN 14 379 7.5e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222216
AA Change: D184V

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Serpinb6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Serpinb6c APN 13 33897338 splice site probably null
IGL01900:Serpinb6c APN 13 33880190 missense possibly damaging 0.88
IGL01983:Serpinb6c APN 13 33897334 splice site probably benign
IGL03357:Serpinb6c APN 13 33895386 missense probably benign 0.08
R0208:Serpinb6c UTSW 13 33897396 missense probably benign
R0242:Serpinb6c UTSW 13 33899247 splice site probably benign
R0632:Serpinb6c UTSW 13 33880031 missense possibly damaging 0.86
R0669:Serpinb6c UTSW 13 33899269 missense probably damaging 0.98
R0848:Serpinb6c UTSW 13 33899305 missense probably damaging 1.00
R1657:Serpinb6c UTSW 13 33880226 missense probably benign 0.01
R3911:Serpinb6c UTSW 13 33893905 missense probably benign 0.00
R5135:Serpinb6c UTSW 13 33880097 missense probably damaging 1.00
R5275:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5295:Serpinb6c UTSW 13 33893817 missense probably damaging 1.00
R5700:Serpinb6c UTSW 13 33899308 missense probably damaging 1.00
R7514:Serpinb6c UTSW 13 33897403 nonsense probably null
R7517:Serpinb6c UTSW 13 33895295 missense probably damaging 1.00
R7547:Serpinb6c UTSW 13 33893892 missense possibly damaging 0.80
R7730:Serpinb6c UTSW 13 33899309 missense probably damaging 1.00
X0063:Serpinb6c UTSW 13 33880705 missense possibly damaging 0.76
Z1088:Serpinb6c UTSW 13 33893872 missense probably damaging 1.00
Z1088:Serpinb6c UTSW 13 33893923 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCTCCTCACAGCTGAGAG -3'
(R):5'- TGCACATATCAGCCACTTTTGTTAG -3'

Sequencing Primer
(F):5'- TCCTCACAGCTGAGAGAGGGTC -3'
(R):5'- TTGCTATGAAGAGACACCCTG -3'
Posted On2019-10-17