Incidental Mutation 'R7490:Hivep1'
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Namehuman immunodeficiency virus type I enhancer binding protein 1
SynonymsCryabp1, alphaA-CRYBP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location42052021-42192537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42157650 bp
Amino Acid Change Valine to Aspartic acid at position 1122 (V1122D)
Ref Sequence ENSEMBL: ENSMUSP00000056147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148] [ENSMUST00000220525]
Predicted Effect probably damaging
Transcript: ENSMUST00000060148
AA Change: V1122D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366
AA Change: V1122D

coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220525
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42154649 missense probably benign 0.00
IGL00572:Hivep1 APN 13 42158871 missense probably benign 0.00
IGL00820:Hivep1 APN 13 42183818 missense probably benign 0.29
IGL00846:Hivep1 APN 13 42167616 nonsense probably null
IGL01068:Hivep1 APN 13 42159984 missense probably benign 0.00
IGL01431:Hivep1 APN 13 42158017 missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42159279 missense probably benign 0.18
IGL01833:Hivep1 APN 13 42154988 nonsense probably null
IGL02037:Hivep1 APN 13 42156077 missense probably benign 0.00
IGL02375:Hivep1 APN 13 42156449 missense probably benign 0.30
IGL02414:Hivep1 APN 13 42154909 missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42155654 missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42157311 missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42157685 missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42155936 missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42158904 missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42156128 missense probably benign 0.12
PIT4305001:Hivep1 UTSW 13 42181671 missense
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0078:Hivep1 UTSW 13 42156041 missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42155435 missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42156153 missense probably benign
R0245:Hivep1 UTSW 13 42164290 missense possibly damaging 0.93
R0348:Hivep1 UTSW 13 42158379 missense possibly damaging 0.65
R0654:Hivep1 UTSW 13 42159756 missense probably benign 0.16
R0655:Hivep1 UTSW 13 42167585 missense probably damaging 1.00
R0717:Hivep1 UTSW 13 42154946 missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42156962 missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42157521 missense probably benign 0.03
R1256:Hivep1 UTSW 13 42181831 missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42158043 missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42157140 missense probably benign 0.03
R1438:Hivep1 UTSW 13 42158120 missense probably benign 0.00
R1672:Hivep1 UTSW 13 42160284 missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42157931 missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1909:Hivep1 UTSW 13 42155646 missense probably benign 0.38
R1993:Hivep1 UTSW 13 42157493 missense probably benign 0.00
R2004:Hivep1 UTSW 13 42160149 missense possibly damaging 0.47
R2061:Hivep1 UTSW 13 42160124 missense possibly damaging 0.80
R2069:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42156318 missense probably damaging 0.98
R2076:Hivep1 UTSW 13 42164393 critical splice donor site probably null
R2085:Hivep1 UTSW 13 42183750 missense probably benign 0.34
R3701:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3702:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3716:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3720:Hivep1 UTSW 13 42158601 missense probably benign 0.01
R3820:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R4379:Hivep1 UTSW 13 42155430 missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42155813 missense probably benign
R4587:Hivep1 UTSW 13 42156228 missense probably benign 0.00
R4604:Hivep1 UTSW 13 42159749 missense probably benign 0.08
R4686:Hivep1 UTSW 13 42155850 missense probably benign 0.00
R4725:Hivep1 UTSW 13 42163411 missense probably benign 0.19
R4924:Hivep1 UTSW 13 42158316 missense probably benign 0.20
R5009:Hivep1 UTSW 13 42158753 missense probably benign 0.06
R5320:Hivep1 UTSW 13 42159639 missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42164395 splice site probably null
R5498:Hivep1 UTSW 13 42123158 critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42158328 missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42156650 missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42160117 missense probably benign
R5635:Hivep1 UTSW 13 42160127 missense probably benign 0.16
R5636:Hivep1 UTSW 13 42163456 missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42156612 missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42157218 missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42160188 missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42184458 missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42158370 missense probably benign 0.01
R6247:Hivep1 UTSW 13 42157490 missense probably benign
R6343:Hivep1 UTSW 13 42159671 nonsense probably null
R6631:Hivep1 UTSW 13 42156480 missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42164284 missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42154727 missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42157081 missense probably benign 0.00
R6800:Hivep1 UTSW 13 42157376 missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42156507 missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42183452 missense probably benign 0.00
R6993:Hivep1 UTSW 13 42158714 missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42157338 missense probably benign 0.26
R7139:Hivep1 UTSW 13 42159954 missense probably benign 0.28
R7186:Hivep1 UTSW 13 42156338 missense probably benign 0.01
R7227:Hivep1 UTSW 13 42156911 missense probably benign 0.02
R7263:Hivep1 UTSW 13 42158192 missense possibly damaging 0.50
R7438:Hivep1 UTSW 13 42154911 missense probably damaging 0.99
R7583:Hivep1 UTSW 13 42164240 missense probably damaging 1.00
R7708:Hivep1 UTSW 13 42164277 nonsense probably null
R7763:Hivep1 UTSW 13 42159461 missense probably benign 0.12
R7840:Hivep1 UTSW 13 42155352 missense probably benign
R7864:Hivep1 UTSW 13 42158814 missense probably benign 0.02
R7913:Hivep1 UTSW 13 42156366 missense probably benign 0.00
R7934:Hivep1 UTSW 13 42154698 missense probably benign 0.17
R8017:Hivep1 UTSW 13 42167622 missense
R8019:Hivep1 UTSW 13 42167622 missense
R8312:Hivep1 UTSW 13 42155177 missense possibly damaging 0.80
R8336:Hivep1 UTSW 13 42155929 missense probably benign 0.00
R8415:Hivep1 UTSW 13 42155429 missense probably benign 0.20
R8477:Hivep1 UTSW 13 42184220 missense probably benign 0.00
X0060:Hivep1 UTSW 13 42154985 missense probably benign 0.07
X0067:Hivep1 UTSW 13 42156717 missense probably damaging 0.98
Z1177:Hivep1 UTSW 13 42159981 missense possibly damaging 0.85
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-10-17