Mutagenetix > Incidental Mutations

Incidental Mutation 'R7490:Washc5'

580709

Institutional Source

Beutler Lab

Gene Symbol

Washc5

Ensembl Gene

ENSMUSG00000022350

Gene Name

WASH complex subunit 5

Synonyms

E430025E21Rik, strumpellin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.905) question?

Stock #

R7490 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59331997-59374167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 59337204 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1057 (N1057I)

Ref Sequence

ENSEMBL: ENSMUSP00000022976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]

Predicted Effect

probably benign
Transcript: ENSMUST00000022976
AA Change: N1057I

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: N1057I

Domain	Start	End	E-Value	Type
Pfam:Strumpellin	23	1103	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000227725
AA Change: N607I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700019A02Rik	T	C	1: 53,163,230	D132G	possibly damaging	Het
Abca5	T	C	11: 110,277,611	E1424G	possibly damaging	Het
Adamts4	C	T	1: 171,256,600	Q549*	probably null	Het
Adcy4	A	G	14: 55,770,433	I893T	possibly damaging	Het
Ago1	A	T	4: 126,439,505	*858R	probably null	Het
Ank2	T	A	3: 126,958,889	I393L	probably damaging	Het
Ankrd44	T	C	1: 54,648,300	T987A	probably benign	Het
Ap2a1	G	T	7: 44,902,789	N790K	probably benign	Het
Aqr	A	G	2: 114,158,868		probably null	Het
Arel1	G	T	12: 84,941,911	F21L	probably damaging	Het
Atp1a3	T	C	7: 24,987,470	D743G	probably damaging	Het
Atp9a	A	T	2: 168,675,352	F354I	probably benign	Het
Bag6	A	G	17: 35,140,842	H259R	unknown	Het
BC028528	TGGTT	TGGTTCTGTGGTCACGGGTT	3: 95,888,186		probably benign	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
BC028528	GTCACTGGTTCTGTG	GTCACTGGTTCTGTGTTCACTGGTTCTGTG	3: 95,888,166		probably benign	Het
Bckdk	T	A	7: 127,904,973	S15T	unknown	Het
C4b	G	T	17: 34,731,080	Y1405*	probably null	Het
Camk4	G	A	18: 32,939,545		probably null	Het
Car11	T	A	7: 45,700,318	W16R	probably benign	Het
Ccdc80	A	C	16: 45,096,400	E506D	probably damaging	Het
Chmp6	C	T	11: 119,915,443	Q32*	probably null	Het
Colq	G	A	14: 31,545,086	P166S	possibly damaging	Het
Ctxn3	T	C	18: 57,477,285	M58T	probably damaging	Het
Cxcl3	A	T	5: 90,786,657	I93L	unknown	Het
Dnaaf2	T	C	12: 69,197,606	Y227C	probably damaging	Het
Dner	CGCTGCTGCTGCTGCTGCTGCTGCTGC	CGCTGCTGCTGCTGCTGCTGCTGC	1: 84,585,549		probably benign	Het
Dnmt3a	G	A	12: 3,904,204	G792D	probably damaging	Het
Dsg4	T	A	18: 20,451,936		probably null	Het
Ecm2	C	T	13: 49,530,342	Q599*	probably null	Het
Fbxl13	T	A	5: 21,523,060	R550*	probably null	Het
Gm4302	A	T	10: 100,341,583	Q243L	unknown	Het
Gm7168	A	T	17: 13,949,013	Y214F	probably benign	Het
Gtf3c1	C	T	7: 125,647,491	D1549N	probably damaging	Het
Gtf3c5	A	T	2: 28,571,141	D320E	probably damaging	Het
Hivep1	T	A	13: 42,157,650	V1122D	probably damaging	Het
Ibtk	T	C	9: 85,718,934		probably null	Het
Irs1	T	A	1: 82,287,264	Q1077L	probably damaging	Het
Ivd	A	T	2: 118,876,892	M296L	possibly damaging	Het
Katnal1	T	C	5: 148,891,682	D318G	probably null	Het
L3mbtl3	C	T	10: 26,339,231	V194I	unknown	Het
Malt1	C	A	18: 65,448,211	Q237K	probably benign	Het
March11	C	T	15: 26,311,101	A221V	possibly damaging	Het
Mgea5	G	A	19: 45,767,447	R586*	probably null	Het
Nfe2l3	A	G	6: 51,457,544	I361M	possibly damaging	Het
Nrg1	G	A	8: 31,818,654	R493C	probably damaging	Het
Olfr1019	A	T	2: 85,840,963	V276E	probably damaging	Het
Olfr1212	A	C	2: 88,959,048	Y194S	probably benign	Het
Olfr453	T	C	6: 42,744,805	I256T	probably damaging	Het
Olfr577	G	A	7: 102,973,810	P61S	probably damaging	Het
Olfr828	A	T	9: 18,815,933	Y120*	probably null	Het
Olfr980	T	A	9: 40,006,424	H175L	probably damaging	Het
Orai3	C	T	7: 127,773,627	A100V	possibly damaging	Het
Oxsm	T	A	14: 16,241,066	M328L	probably benign	Het
Pan2	T	C	10: 128,308,440	V186A	probably benign	Het
Pkd1l1	T	A	11: 8,916,265	D980V		Het
Ppp1r16b	T	C	2: 158,761,468	Y438H	probably damaging	Het
Ppp4c	A	T	7: 126,787,332	H164Q	probably damaging	Het
Prl8a2	C	A	13: 27,352,770	T125K	possibly damaging	Het
Rasa2	T	C	9: 96,566,122	N494S	possibly damaging	Het
Rpl18a	T	C	8: 70,895,506	D147G	probably benign	Het
Scg3	T	C	9: 75,669,277	D272G	possibly damaging	Het
Serpinb6c	T	A	13: 33,893,835	D184V	probably benign	Het
Simc1	T	G	13: 54,524,349	L170R	possibly damaging	Het
Slx4	T	C	16: 3,980,131	E1463G	possibly damaging	Het
Stk31	T	A	6: 49,439,232		probably null	Het
Tas1r3	A	G	4: 155,862,023	I375T	probably damaging	Het
Tbc1d24	T	C	17: 24,182,520	D405G	probably damaging	Het
Tcerg1l	G	A	7: 138,259,828	P391S	probably damaging	Het
Tiam1	T	C	16: 89,898,195	S125G	probably benign	Het
Trim16	C	A	11: 62,834,123	H246N	probably damaging	Het
Tti1	T	A	2: 157,995,472	N896I	probably damaging	Het
Ubash3a	A	G	17: 31,232,312	N395S	probably damaging	Het
Uggt1	T	C	1: 36,164,508	I1014V	probably benign	Het
Vmn1r30	T	A	6: 58,435,229	Q206L	possibly damaging	Het
Xpo4	GGTATTAGCGGAGT	GGT	14: 57,602,621		probably null	Het
Zcchc14	A	T	8: 121,605,017	S536T	unknown	Het

Other mutations in Washc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Washc5	APN	15	59337276	missense	probably damaging	0.99
IGL01096:Washc5	APN	15	59350211	splice site	probably benign
IGL01305:Washc5	APN	15	59355839	nonsense	probably null
IGL01707:Washc5	APN	15	59342015	missense	possibly damaging	0.89
IGL01921:Washc5	APN	15	59342109	splice site	probably null
IGL02056:Washc5	APN	15	59350336	missense	possibly damaging	0.63
IGL02145:Washc5	APN	15	59369211	missense	probably benign
IGL02430:Washc5	APN	15	59366291	missense	probably damaging	1.00
IGL02450:Washc5	APN	15	59332317	nonsense	probably null
IGL03238:Washc5	APN	15	59346842	missense	probably damaging	1.00
IGL03351:Washc5	APN	15	59363350	splice site	probably benign
ANU22:Washc5	UTSW	15	59355839	nonsense	probably null
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0179:Washc5	UTSW	15	59352530	missense	probably benign	0.01
R0265:Washc5	UTSW	15	59338960	missense	probably benign	0.43
R0315:Washc5	UTSW	15	59341976	missense	probably damaging	1.00
R0545:Washc5	UTSW	15	59342093	missense	possibly damaging	0.50
R0611:Washc5	UTSW	15	59341158	missense	probably damaging	0.99
R0636:Washc5	UTSW	15	59359409	missense	probably benign	0.01
R1006:Washc5	UTSW	15	59369186	missense	probably benign	0.21
R1006:Washc5	UTSW	15	59369187	missense	probably benign	0.06
R1237:Washc5	UTSW	15	59338908	splice site	probably benign
R1835:Washc5	UTSW	15	59359340	missense	possibly damaging	0.86
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R2005:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2006:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2060:Washc5	UTSW	15	59350408	missense	probably damaging	1.00
R2134:Washc5	UTSW	15	59369234	missense	probably damaging	1.00
R2139:Washc5	UTSW	15	59350142	missense	probably damaging	1.00
R2177:Washc5	UTSW	15	59363269	nonsense	probably null
R2975:Washc5	UTSW	15	59345358	missense	probably damaging	1.00
R4088:Washc5	UTSW	15	59339862	missense	probably damaging	1.00
R4824:Washc5	UTSW	15	59333636	nonsense	probably null
R4843:Washc5	UTSW	15	59350371	missense	possibly damaging	0.95
R4991:Washc5	UTSW	15	59344080	missense	probably damaging	1.00
R4996:Washc5	UTSW	15	59333635	missense	probably benign
R5103:Washc5	UTSW	15	59350169	missense	probably damaging	1.00
R5312:Washc5	UTSW	15	59345528	splice site	probably null
R5591:Washc5	UTSW	15	59369163	missense	probably damaging	1.00
R6073:Washc5	UTSW	15	59335170	missense	possibly damaging	0.90
R6123:Washc5	UTSW	15	59335110	missense	probably damaging	1.00
R6156:Washc5	UTSW	15	59345399	missense	probably damaging	1.00
R6292:Washc5	UTSW	15	59355934	missense	probably damaging	1.00
R6297:Washc5	UTSW	15	59344046	missense	possibly damaging	0.61
R6374:Washc5	UTSW	15	59337195	missense	probably benign	0.14
R6659:Washc5	UTSW	15	59340890	critical splice donor site	probably null
R6880:Washc5	UTSW	15	59350172	missense	probably benign	0.00
R7146:Washc5	UTSW	15	59352501	nonsense	probably null
R7330:Washc5	UTSW	15	59333667	missense	probably benign	0.02
R7430:Washc5	UTSW	15	59369913	nonsense	probably null
R7532:Washc5	UTSW	15	59367411	missense	possibly damaging	0.46
R7560:Washc5	UTSW	15	59366192	missense	probably damaging	0.97
R7803:Washc5	UTSW	15	59368459	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ATCTGGAGCCCACTGTGTAC -3'
(R):5'- TGAGGACATCTCTACAGGCAG -3'

Sequencing Primer
(F):5'- GTGTACACTCCATCCGTGGTATG -3'
(R):5'- AGATGACACAGCTGTCCCAGTTG -3'

Posted On

2019-10-17