Incidental Mutation 'R7490:Washc5'
Institutional Source Beutler Lab
Gene Symbol Washc5
Ensembl Gene ENSMUSG00000022350
Gene NameWASH complex subunit 5
SynonymsE430025E21Rik, strumpellin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location59331997-59374167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59337204 bp
Amino Acid Change Asparagine to Isoleucine at position 1057 (N1057I)
Ref Sequence ENSEMBL: ENSMUSP00000022976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]
Predicted Effect probably benign
Transcript: ENSMUST00000022976
AA Change: N1057I

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: N1057I

Pfam:Strumpellin 23 1103 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227725
AA Change: N607I

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Slx4 T C 16: 3,980,131 E1463G possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Washc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Washc5 APN 15 59337276 missense probably damaging 0.99
IGL01096:Washc5 APN 15 59350211 splice site probably benign
IGL01305:Washc5 APN 15 59355839 nonsense probably null
IGL01707:Washc5 APN 15 59342015 missense possibly damaging 0.89
IGL01921:Washc5 APN 15 59342109 splice site probably null
IGL02056:Washc5 APN 15 59350336 missense possibly damaging 0.63
IGL02145:Washc5 APN 15 59369211 missense probably benign
IGL02430:Washc5 APN 15 59366291 missense probably damaging 1.00
IGL02450:Washc5 APN 15 59332317 nonsense probably null
IGL03238:Washc5 APN 15 59346842 missense probably damaging 1.00
IGL03351:Washc5 APN 15 59363350 splice site probably benign
ANU22:Washc5 UTSW 15 59355839 nonsense probably null
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0179:Washc5 UTSW 15 59352530 missense probably benign 0.01
R0265:Washc5 UTSW 15 59338960 missense probably benign 0.43
R0315:Washc5 UTSW 15 59341976 missense probably damaging 1.00
R0545:Washc5 UTSW 15 59342093 missense possibly damaging 0.50
R0611:Washc5 UTSW 15 59341158 missense probably damaging 0.99
R0636:Washc5 UTSW 15 59359409 missense probably benign 0.01
R1006:Washc5 UTSW 15 59369186 missense probably benign 0.21
R1006:Washc5 UTSW 15 59369187 missense probably benign 0.06
R1237:Washc5 UTSW 15 59338908 splice site probably benign
R1835:Washc5 UTSW 15 59359340 missense possibly damaging 0.86
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R2005:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2006:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2060:Washc5 UTSW 15 59350408 missense probably damaging 1.00
R2134:Washc5 UTSW 15 59369234 missense probably damaging 1.00
R2139:Washc5 UTSW 15 59350142 missense probably damaging 1.00
R2177:Washc5 UTSW 15 59363269 nonsense probably null
R2975:Washc5 UTSW 15 59345358 missense probably damaging 1.00
R4088:Washc5 UTSW 15 59339862 missense probably damaging 1.00
R4824:Washc5 UTSW 15 59333636 nonsense probably null
R4843:Washc5 UTSW 15 59350371 missense possibly damaging 0.95
R4991:Washc5 UTSW 15 59344080 missense probably damaging 1.00
R4996:Washc5 UTSW 15 59333635 missense probably benign
R5103:Washc5 UTSW 15 59350169 missense probably damaging 1.00
R5312:Washc5 UTSW 15 59345528 splice site probably null
R5591:Washc5 UTSW 15 59369163 missense probably damaging 1.00
R6073:Washc5 UTSW 15 59335170 missense possibly damaging 0.90
R6123:Washc5 UTSW 15 59335110 missense probably damaging 1.00
R6156:Washc5 UTSW 15 59345399 missense probably damaging 1.00
R6292:Washc5 UTSW 15 59355934 missense probably damaging 1.00
R6297:Washc5 UTSW 15 59344046 missense possibly damaging 0.61
R6374:Washc5 UTSW 15 59337195 missense probably benign 0.14
R6659:Washc5 UTSW 15 59340890 critical splice donor site probably null
R6880:Washc5 UTSW 15 59350172 missense probably benign 0.00
R7146:Washc5 UTSW 15 59352501 nonsense probably null
R7330:Washc5 UTSW 15 59333667 missense probably benign 0.02
R7430:Washc5 UTSW 15 59369913 nonsense probably null
R7532:Washc5 UTSW 15 59367411 missense possibly damaging 0.46
R7560:Washc5 UTSW 15 59366192 missense probably damaging 0.97
R7803:Washc5 UTSW 15 59368459 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-10-17