Incidental Mutation 'R7490:Slx4'
ID580710
Institutional Source Beutler Lab
Gene Symbol Slx4
Ensembl Gene ENSMUSG00000039738
Gene NameSLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
SynonymsBtbd12, D16Bwg1016e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7490 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location3979105-4003770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3980131 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1463 (E1463G)
Ref Sequence ENSEMBL: ENSMUSP00000038871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040790] [ENSMUST00000177551] [ENSMUST00000180200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040790
AA Change: E1463G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: E1463G

DomainStartEndE-ValueType
low complexity region 400 413 N/A INTRINSIC
BTB 506 609 6.15e-7 SMART
low complexity region 651 667 N/A INTRINSIC
low complexity region 833 849 N/A INTRINSIC
low complexity region 857 875 N/A INTRINSIC
low complexity region 1176 1192 N/A INTRINSIC
low complexity region 1437 1461 N/A INTRINSIC
Pfam:Slx4 1484 1541 3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146569
SMART Domains Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

DomainStartEndE-ValueType
Pfam:BTB 6 102 6.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156542
Predicted Effect probably benign
Transcript: ENSMUST00000177551
SMART Domains Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
Pfam:NACHT 176 342 2e-34 PFAM
LRR 702 729 3.11e-2 SMART
LRR 730 757 2.27e-4 SMART
LRR 758 785 8.15e-1 SMART
LRR 786 813 2.17e-1 SMART
LRR 814 841 2.12e-4 SMART
LRR 842 869 3.42e0 SMART
LRR 870 897 7.67e-2 SMART
LRR 898 925 3.21e0 SMART
LRR 926 953 1.67e0 SMART
LRR 954 981 4.87e-4 SMART
LRR 982 1009 4.3e0 SMART
LRR 1010 1037 3.8e-6 SMART
LRR 1038 1065 4.47e-3 SMART
LRR 1066 1093 1.08e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180200
SMART Domains Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871

DomainStartEndE-ValueType
LRR 4 24 8.65e1 SMART
LRR 25 52 2.27e-4 SMART
LRR 53 80 8.15e-1 SMART
LRR 81 108 2.17e-1 SMART
LRR 109 136 2.12e-4 SMART
LRR 137 164 3.42e0 SMART
LRR 165 192 7.67e-2 SMART
LRR 193 220 3.21e0 SMART
LRR 221 248 1.67e0 SMART
LRR 249 276 4.87e-4 SMART
LRR 277 304 4.3e0 SMART
LRR 305 332 3.8e-6 SMART
LRR 333 360 4.47e-3 SMART
LRR 361 388 1.08e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik T C 1: 53,163,230 D132G possibly damaging Het
Abca5 T C 11: 110,277,611 E1424G possibly damaging Het
Adamts4 C T 1: 171,256,600 Q549* probably null Het
Adcy4 A G 14: 55,770,433 I893T possibly damaging Het
Ago1 A T 4: 126,439,505 *858R probably null Het
Ank2 T A 3: 126,958,889 I393L probably damaging Het
Ankrd44 T C 1: 54,648,300 T987A probably benign Het
Ap2a1 G T 7: 44,902,789 N790K probably benign Het
Aqr A G 2: 114,158,868 probably null Het
Arel1 G T 12: 84,941,911 F21L probably damaging Het
Atp1a3 T C 7: 24,987,470 D743G probably damaging Het
Atp9a A T 2: 168,675,352 F354I probably benign Het
Bag6 A G 17: 35,140,842 H259R unknown Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG 3: 95,888,166 probably benign Het
BC028528 TGGTT TGGTTCTGTGGTCACGGGTT 3: 95,888,186 probably benign Het
Bckdk T A 7: 127,904,973 S15T unknown Het
C4b G T 17: 34,731,080 Y1405* probably null Het
Camk4 G A 18: 32,939,545 probably null Het
Car11 T A 7: 45,700,318 W16R probably benign Het
Ccdc80 A C 16: 45,096,400 E506D probably damaging Het
Chmp6 C T 11: 119,915,443 Q32* probably null Het
Colq G A 14: 31,545,086 P166S possibly damaging Het
Ctxn3 T C 18: 57,477,285 M58T probably damaging Het
Cxcl3 A T 5: 90,786,657 I93L unknown Het
Dnaaf2 T C 12: 69,197,606 Y227C probably damaging Het
Dner CGCTGCTGCTGCTGCTGCTGCTGCTGC CGCTGCTGCTGCTGCTGCTGCTGC 1: 84,585,549 probably benign Het
Dnmt3a G A 12: 3,904,204 G792D probably damaging Het
Dsg4 T A 18: 20,451,936 probably null Het
Ecm2 C T 13: 49,530,342 Q599* probably null Het
Fbxl13 T A 5: 21,523,060 R550* probably null Het
Gm4302 A T 10: 100,341,583 Q243L unknown Het
Gm7168 A T 17: 13,949,013 Y214F probably benign Het
Gtf3c1 C T 7: 125,647,491 D1549N probably damaging Het
Gtf3c5 A T 2: 28,571,141 D320E probably damaging Het
Hivep1 T A 13: 42,157,650 V1122D probably damaging Het
Ibtk T C 9: 85,718,934 probably null Het
Irs1 T A 1: 82,287,264 Q1077L probably damaging Het
Ivd A T 2: 118,876,892 M296L possibly damaging Het
Katnal1 T C 5: 148,891,682 D318G probably null Het
L3mbtl3 C T 10: 26,339,231 V194I unknown Het
Malt1 C A 18: 65,448,211 Q237K probably benign Het
March11 C T 15: 26,311,101 A221V possibly damaging Het
Mgea5 G A 19: 45,767,447 R586* probably null Het
Nfe2l3 A G 6: 51,457,544 I361M possibly damaging Het
Nrg1 G A 8: 31,818,654 R493C probably damaging Het
Olfr1019 A T 2: 85,840,963 V276E probably damaging Het
Olfr1212 A C 2: 88,959,048 Y194S probably benign Het
Olfr453 T C 6: 42,744,805 I256T probably damaging Het
Olfr577 G A 7: 102,973,810 P61S probably damaging Het
Olfr828 A T 9: 18,815,933 Y120* probably null Het
Olfr980 T A 9: 40,006,424 H175L probably damaging Het
Orai3 C T 7: 127,773,627 A100V possibly damaging Het
Oxsm T A 14: 16,241,066 M328L probably benign Het
Pan2 T C 10: 128,308,440 V186A probably benign Het
Pkd1l1 T A 11: 8,916,265 D980V Het
Ppp1r16b T C 2: 158,761,468 Y438H probably damaging Het
Ppp4c A T 7: 126,787,332 H164Q probably damaging Het
Prl8a2 C A 13: 27,352,770 T125K possibly damaging Het
Rasa2 T C 9: 96,566,122 N494S possibly damaging Het
Rpl18a T C 8: 70,895,506 D147G probably benign Het
Scg3 T C 9: 75,669,277 D272G possibly damaging Het
Serpinb6c T A 13: 33,893,835 D184V probably benign Het
Simc1 T G 13: 54,524,349 L170R possibly damaging Het
Stk31 T A 6: 49,439,232 probably null Het
Tas1r3 A G 4: 155,862,023 I375T probably damaging Het
Tbc1d24 T C 17: 24,182,520 D405G probably damaging Het
Tcerg1l G A 7: 138,259,828 P391S probably damaging Het
Tiam1 T C 16: 89,898,195 S125G probably benign Het
Trim16 C A 11: 62,834,123 H246N probably damaging Het
Tti1 T A 2: 157,995,472 N896I probably damaging Het
Ubash3a A G 17: 31,232,312 N395S probably damaging Het
Uggt1 T C 1: 36,164,508 I1014V probably benign Het
Vmn1r30 T A 6: 58,435,229 Q206L possibly damaging Het
Washc5 T A 15: 59,337,204 N1057I probably benign Het
Xpo4 GGTATTAGCGGAGT GGT 14: 57,602,621 probably null Het
Zcchc14 A T 8: 121,605,017 S536T unknown Het
Other mutations in Slx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Slx4 APN 16 3990888 missense probably benign 0.17
IGL01767:Slx4 APN 16 3990248 missense probably benign 0.01
IGL02525:Slx4 APN 16 3980597 missense probably damaging 1.00
slim UTSW 16 3990910 nonsense probably null
R0033:Slx4 UTSW 16 3988000 missense probably benign 0.08
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0363:Slx4 UTSW 16 3980089 missense probably damaging 1.00
R0433:Slx4 UTSW 16 3986018 missense probably benign 0.01
R0993:Slx4 UTSW 16 3985825 missense probably benign 0.00
R1083:Slx4 UTSW 16 3990910 nonsense probably null
R1373:Slx4 UTSW 16 3985510 missense probably benign 0.02
R1710:Slx4 UTSW 16 3999158 missense probably benign 0.15
R1712:Slx4 UTSW 16 3991594 missense probably damaging 0.99
R1874:Slx4 UTSW 16 3986848 missense probably benign 0.25
R1937:Slx4 UTSW 16 3987166 makesense probably null
R2008:Slx4 UTSW 16 3979921 missense probably damaging 1.00
R2156:Slx4 UTSW 16 3986359 missense probably benign 0.00
R2427:Slx4 UTSW 16 3988987 missense probably damaging 0.99
R3765:Slx4 UTSW 16 3980986 missense probably damaging 1.00
R3890:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R3891:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R4465:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4467:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4497:Slx4 UTSW 16 3994909 missense probably damaging 1.00
R4882:Slx4 UTSW 16 3980996 critical splice acceptor site probably null
R5119:Slx4 UTSW 16 4001199 missense possibly damaging 0.89
R5384:Slx4 UTSW 16 3990805 missense probably damaging 1.00
R5472:Slx4 UTSW 16 3991540 missense probably benign 0.13
R5578:Slx4 UTSW 16 3986862 missense probably damaging 1.00
R5582:Slx4 UTSW 16 3985788 missense possibly damaging 0.93
R5696:Slx4 UTSW 16 3979967 missense probably damaging 1.00
R5827:Slx4 UTSW 16 4001284 missense possibly damaging 0.94
R5964:Slx4 UTSW 16 4000951 critical splice donor site probably null
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6345:Slx4 UTSW 16 3990850 missense probably benign 0.06
R6612:Slx4 UTSW 16 3985276 missense probably damaging 0.99
R6979:Slx4 UTSW 16 3985015 missense probably damaging 0.96
R6989:Slx4 UTSW 16 3995838 missense probably damaging 1.00
R7171:Slx4 UTSW 16 3990786 missense probably benign
R7214:Slx4 UTSW 16 3988980 missense probably benign 0.18
R7354:Slx4 UTSW 16 3987099 missense probably benign 0.28
R7545:Slx4 UTSW 16 3999300 missense probably benign 0.11
R7547:Slx4 UTSW 16 3985572 missense probably benign 0.05
R7790:Slx4 UTSW 16 3986982 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATGCCATTCTGTTTCAGCTCAG -3'
(R):5'- AAGTCCCACCTATACTGGCC -3'

Sequencing Primer
(F):5'- GTTTCAGCTCAGCCTGCAG -3'
(R):5'- AGACCTTAGAATACCATCAAAGAGTC -3'
Posted On2019-10-17