Incidental Mutation 'R7491:Stat1'
ID580722
Institutional Source Beutler Lab
Gene Symbol Stat1
Ensembl Gene ENSMUSG00000026104
Gene Namesignal transducer and activator of transcription 1
Synonyms2010005J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7491 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location52119440-52161865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52152371 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 628 (N628K)
Ref Sequence ENSEMBL: ENSMUSP00000141132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070968] [ENSMUST00000186057] [ENSMUST00000186574] [ENSMUST00000186857] [ENSMUST00000189244] [ENSMUST00000189347] [ENSMUST00000191435]
Predicted Effect probably benign
Transcript: ENSMUST00000070968
AA Change: N622K

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104
AA Change: N622K

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 139 315 1.4e-56 PFAM
Pfam:STAT_bind 317 566 4.2e-82 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186057
AA Change: N628K

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141132
Gene: ENSMUSG00000026104
AA Change: N628K

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 3.4e-65 PFAM
Pfam:STAT_bind 317 573 3.9e-118 PFAM
SH2 577 693 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 721 745 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186574
AA Change: N622K

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140518
Gene: ENSMUSG00000026104
AA Change: N622K

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186857
AA Change: N622K

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140875
Gene: ENSMUSG00000026104
AA Change: N622K

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 1.2e-64 PFAM
Pfam:STAT_bind 317 567 4.4e-121 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189244
AA Change: N116K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000140482
Gene: ENSMUSG00000026104
AA Change: N116K

DomainStartEndE-ValueType
Pfam:STAT_bind 13 61 2.6e-14 PFAM
SH2 65 181 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 209 233 7.8e-16 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000189347
AA Change: N622K

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141125
Gene: ENSMUSG00000026104
AA Change: N622K

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191435
AA Change: N622K

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139746
Gene: ENSMUSG00000026104
AA Change: N622K

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,614,755 probably null Het
5730522E02Rik A T 11: 25,769,014 V44E unknown Het
Adcy9 A G 16: 4,418,809 L246S possibly damaging Het
Adk C T 14: 21,234,929 H123Y probably damaging Het
Adra1b T A 11: 43,835,967 D41V probably benign Het
Ankib1 T G 5: 3,701,911 K710Q probably damaging Het
Aoc2 T A 11: 101,328,377 V542D probably benign Het
Arhgef28 T C 13: 97,944,686 N1221S probably benign Het
Arntl T C 7: 113,299,424 V353A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
Cacna1a C A 8: 84,559,293 R856S possibly damaging Het
Cacna1c T C 6: 118,613,343 M1559V Het
Cdh10 G C 15: 19,013,359 E682Q probably damaging Het
Celsr1 T C 15: 86,032,518 D418G possibly damaging Het
Cfap44 T C 16: 44,470,748 L1537P probably damaging Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Col2a1 C T 15: 97,976,159 V1449I not run Het
Cpt2 A G 4: 107,907,142 F475S probably damaging Het
Cpxm1 T C 2: 130,393,567 T502A probably benign Het
Creb3l2 G T 6: 37,379,859 T91N probably benign Het
D630045J12Rik A T 6: 38,142,666 S1714T possibly damaging Het
Dennd1c C A 17: 57,072,379 V246F probably damaging Het
Dse A G 10: 34,152,565 V843A probably benign Het
Ern2 C A 7: 122,170,533 W810L probably damaging Het
Fer1l6 G A 15: 58,600,432 D906N probably damaging Het
Fry A G 5: 150,466,326 E140G Het
Galnt7 A G 8: 57,552,518 V227A probably damaging Het
Gas2l3 A G 10: 89,413,901 S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm826 A T 2: 160,312,022 S34T unknown Het
Gzmk A T 13: 113,172,001 I222N probably benign Het
Hivep3 A T 4: 120,098,830 T1448S probably benign Het
Hk1 T C 10: 62,295,745 D278G probably damaging Het
Ipo7 C A 7: 110,039,194 Q223K possibly damaging Het
Itga9 T A 9: 118,769,111 I571N probably damaging Het
Itgb6 T C 2: 60,620,376 Y573C probably damaging Het
Kmt2c T A 5: 25,284,564 H4459L probably damaging Het
Limch1 T G 5: 67,054,237 S894R probably damaging Het
Lrit2 A T 14: 37,068,910 Q182L possibly damaging Het
Mlph A T 1: 90,939,378 H374L possibly damaging Het
Mmrn2 A G 14: 34,399,417 H748R probably damaging Het
Mrpl58 T C 11: 115,410,266 V134A possibly damaging Het
Nae1 A T 8: 104,518,239 D353E probably benign Het
Naip5 A C 13: 100,217,071 F1227V probably benign Het
Nln A T 13: 104,069,323 F108I probably damaging Het
Nop16 C T 13: 54,588,604 V94I probably benign Het
Nt5c1b A T 12: 10,374,903 T150S probably benign Het
Olfr960 T G 9: 39,623,972 I281S possibly damaging Het
Pcdha4 T C 18: 36,954,636 V624A probably damaging Het
Pcdhga8 T C 18: 37,727,430 I513T probably benign Het
Prc1 A T 7: 80,309,491 probably null Het
Prpf4 T A 4: 62,417,876 F280Y probably damaging Het
Ptprd T C 4: 76,133,155 E43G probably benign Het
Pum1 T A 4: 130,719,174 D181E probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Rgs1 T C 1: 144,245,396 Y179C probably damaging Het
Rrm1 T C 7: 102,454,557 C238R probably damaging Het
Rusc2 T A 4: 43,426,528 L1484Q probably damaging Het
Sall3 C T 18: 80,972,705 M669I probably benign Het
Saxo1 A C 4: 86,445,407 F280V probably benign Het
Scn2a T C 2: 65,702,008 S655P probably damaging Het
Senp6 G T 9: 80,123,728 E571* probably null Het
Sin3b C G 8: 72,746,441 T463S probably damaging Het
Sirt7 C A 11: 120,619,011 R349L probably benign Het
Skor1 T C 9: 63,146,448 T80A probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc25a23 T A 17: 57,052,822 R310* probably null Het
Slco6c1 A T 1: 97,127,854 H107Q probably benign Het
Slit2 A G 5: 48,219,994 E455G probably benign Het
Smo G C 6: 29,736,120 G37A probably damaging Het
St6galnac1 T C 11: 116,769,184 K101R probably benign Het
Syn2 A T 6: 115,254,654 Y302F probably benign Het
Tapt1 T G 5: 44,188,636 Q324P probably damaging Het
Tcrg-V3 T A 13: 19,242,846 M1K probably null Het
Tgoln1 C T 6: 72,616,420 A26T unknown Het
Timm13 T A 10: 80,900,544 T43S probably benign Het
Tnfrsf19 G A 14: 61,005,205 P77S possibly damaging Het
Trem3 T G 17: 48,257,941 F157V probably benign Het
Trim33 T A 3: 103,326,148 S420T probably benign Het
Trip11 T C 12: 101,885,435 K790R probably damaging Het
Trnt1 A G 6: 106,778,904 T307A probably benign Het
Tshz1 T C 18: 84,015,641 Y214C probably damaging Het
Vmn2r105 T A 17: 20,228,565 T117S probably benign Het
Vmn2r45 A G 7: 8,481,343 Y488H probably benign Het
Vwa8 A T 14: 79,082,814 K1088N probably benign Het
Wdr35 T C 12: 8,986,000 V257A probably benign Het
Zfp189 T A 4: 49,521,569 S3T probably benign Het
Zscan22 G A 7: 12,906,906 C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,517,885 R283* probably null Het
Other mutations in Stat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 start codon destroyed probably null 0.50
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.87
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 1.00
IGL01913:Stat1 APN 1 52126557 missense probably benign 0.08
IGL01914:Stat1 APN 1 52126557 missense probably benign 0.08
IGL02304:Stat1 APN 1 52132544 missense probably benign
IGL02428:Stat1 APN 1 52142966 splice site probably benign
domino UTSW 1 52140588 missense probably damaging 1.00
poison UTSW 1 52151225 splice site probably benign
roccoco UTSW 1 52123209 missense probably damaging 1.00
rollo UTSW 1 52153923 nonsense probably null
special UTSW 1 52139264 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.99
R0458:Stat1 UTSW 1 52149052 splice site probably benign
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4464:Stat1 UTSW 1 52137416 missense possibly damaging 0.52
R4709:Stat1 UTSW 1 52126521 missense probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5038:Stat1 UTSW 1 52123209 missense probably damaging 1.00
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R5866:Stat1 UTSW 1 52139264 missense probably damaging 1.00
R7105:Stat1 UTSW 1 52151249 missense probably benign 0.01
R7192:Stat1 UTSW 1 52135621 missense possibly damaging 0.65
R7284:Stat1 UTSW 1 52148922 missense probably benign 0.01
R7309:Stat1 UTSW 1 52126621 splice site probably null
R7680:Stat1 UTSW 1 52144209 missense probably damaging 1.00
R7825:Stat1 UTSW 1 52151308 missense probably damaging 0.98
RF036:Stat1 UTSW 1 52152260 missense probably benign
RF060:Stat1 UTSW 1 52152260 missense probably benign
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGGAAACACAAAGCGTCTC -3'
(R):5'- TTGGCCTTGCTTTGAAATGC -3'

Sequencing Primer
(F):5'- GGGAAACACAAAGCGTCTCCATTC -3'
(R):5'- TCCACAACACGTTTCCGGG -3'
Posted On2019-10-17