Incidental Mutation 'R7491:Rgs1'
ID 580725
Institutional Source Beutler Lab
Gene Symbol Rgs1
Ensembl Gene ENSMUSG00000026358
Gene Name regulator of G-protein signaling 1
Synonyms BL34
MMRRC Submission 045565-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.115) question?
Stock # R7491 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 144120407-144124862 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144121134 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 179 (Y179C)
Ref Sequence ENSEMBL: ENSMUSP00000140624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167317] [ENSMUST00000169409] [ENSMUST00000172388] [ENSMUST00000185714] [ENSMUST00000189061]
AlphaFold Q9JL25
Predicted Effect probably benign
Transcript: ENSMUST00000167317
Predicted Effect probably benign
Transcript: ENSMUST00000167812
Predicted Effect probably benign
Transcript: ENSMUST00000169409
Predicted Effect probably benign
Transcript: ENSMUST00000172388
SMART Domains Protein: ENSMUSP00000130339
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185714
SMART Domains Protein: ENSMUSP00000140902
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 58 128 2.8e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189061
AA Change: Y179C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140624
Gene: ENSMUSG00000026358
AA Change: Y179C

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased splenic B cell germinal centers, increased chemotactic responses in B cells and immature dendritic cells, and decreased antibody secreting cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,445,099 (GRCm39) probably null Het
5730522E02Rik A T 11: 25,719,014 (GRCm39) V44E unknown Het
Adcy9 A G 16: 4,236,673 (GRCm39) L246S possibly damaging Het
Adk C T 14: 21,284,997 (GRCm39) H123Y probably damaging Het
Adra1b T A 11: 43,726,794 (GRCm39) D41V probably benign Het
Ankib1 T G 5: 3,751,911 (GRCm39) K710Q probably damaging Het
Aoc2 T A 11: 101,219,203 (GRCm39) V542D probably benign Het
Arhgef28 T C 13: 98,081,194 (GRCm39) N1221S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,795,450 (GRCm39) probably benign Het
Bmal1 T C 7: 112,898,631 (GRCm39) V353A probably benign Het
Cacna1a C A 8: 85,285,922 (GRCm39) R856S possibly damaging Het
Cacna1c T C 6: 118,590,304 (GRCm39) M1559V Het
Cdh10 G C 15: 19,013,445 (GRCm39) E682Q probably damaging Het
Celsr1 T C 15: 85,916,719 (GRCm39) D418G possibly damaging Het
Cfap44 T C 16: 44,291,111 (GRCm39) L1537P probably damaging Het
Clca3a2 A G 3: 144,519,340 (GRCm39) S279P probably damaging Het
Col2a1 C T 15: 97,874,040 (GRCm39) V1449I not run Het
Cpt2 A G 4: 107,764,339 (GRCm39) F475S probably damaging Het
Cpxm1 T C 2: 130,235,487 (GRCm39) T502A probably benign Het
Creb3l2 G T 6: 37,356,794 (GRCm39) T91N probably benign Het
D630045J12Rik A T 6: 38,119,601 (GRCm39) S1714T possibly damaging Het
Dennd1c C A 17: 57,379,379 (GRCm39) V246F probably damaging Het
Dse A G 10: 34,028,561 (GRCm39) V843A probably benign Het
Ern2 C A 7: 121,769,756 (GRCm39) W810L probably damaging Het
Fer1l6 G A 15: 58,472,281 (GRCm39) D906N probably damaging Het
Fry A G 5: 150,389,791 (GRCm39) E140G Het
Galnt7 A G 8: 58,005,552 (GRCm39) V227A probably damaging Het
Gas2l3 A G 10: 89,249,763 (GRCm39) S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gm826 A T 2: 160,153,942 (GRCm39) S34T unknown Het
Gzmk A T 13: 113,308,535 (GRCm39) I222N probably benign Het
Hivep3 A T 4: 119,956,027 (GRCm39) T1448S probably benign Het
Hk1 T C 10: 62,131,524 (GRCm39) D278G probably damaging Het
Ipo7 C A 7: 109,638,401 (GRCm39) Q223K possibly damaging Het
Itga9 T A 9: 118,598,179 (GRCm39) I571N probably damaging Het
Itgb6 T C 2: 60,450,720 (GRCm39) Y573C probably damaging Het
Kmt2c T A 5: 25,489,562 (GRCm39) H4459L probably damaging Het
Limch1 T G 5: 67,211,580 (GRCm39) S894R probably damaging Het
Lrit2 A T 14: 36,790,867 (GRCm39) Q182L possibly damaging Het
Mlph A T 1: 90,867,100 (GRCm39) H374L possibly damaging Het
Mmrn2 A G 14: 34,121,374 (GRCm39) H748R probably damaging Het
Mrpl58 T C 11: 115,301,092 (GRCm39) V134A possibly damaging Het
Nae1 A T 8: 105,244,871 (GRCm39) D353E probably benign Het
Naip5 A C 13: 100,353,579 (GRCm39) F1227V probably benign Het
Nln A T 13: 104,205,831 (GRCm39) F108I probably damaging Het
Nop16 C T 13: 54,736,417 (GRCm39) V94I probably benign Het
Nt5c1b A T 12: 10,424,903 (GRCm39) T150S probably benign Het
Or10d4b T G 9: 39,535,268 (GRCm39) I281S possibly damaging Het
Pcdha4 T C 18: 37,087,689 (GRCm39) V624A probably damaging Het
Pcdhga8 T C 18: 37,860,483 (GRCm39) I513T probably benign Het
Prc1 A T 7: 79,959,239 (GRCm39) probably null Het
Prpf4 T A 4: 62,336,113 (GRCm39) F280Y probably damaging Het
Ptprd T C 4: 76,051,392 (GRCm39) E43G probably benign Het
Pum1 T A 4: 130,446,485 (GRCm39) D181E probably benign Het
Rab7 A G 6: 87,990,624 (GRCm39) S17P probably damaging Het
Rrm1 T C 7: 102,103,764 (GRCm39) C238R probably damaging Het
Rusc2 T A 4: 43,426,528 (GRCm39) L1484Q probably damaging Het
Sall3 C T 18: 81,015,920 (GRCm39) M669I probably benign Het
Saxo1 A C 4: 86,363,644 (GRCm39) F280V probably benign Het
Scn2a T C 2: 65,532,352 (GRCm39) S655P probably damaging Het
Senp6 G T 9: 80,031,010 (GRCm39) E571* probably null Het
Sin3b C G 8: 73,473,069 (GRCm39) T463S probably damaging Het
Sirt7 C A 11: 120,509,837 (GRCm39) R349L probably benign Het
Skor1 T C 9: 63,053,730 (GRCm39) T80A probably damaging Het
Slc12a9 C A 5: 137,321,082 (GRCm39) A478S probably damaging Het
Slc25a23 T A 17: 57,359,822 (GRCm39) R310* probably null Het
Slco6c1 A T 1: 97,055,579 (GRCm39) H107Q probably benign Het
Slit2 A G 5: 48,377,336 (GRCm39) E455G probably benign Het
Smo G C 6: 29,736,119 (GRCm39) G37A probably damaging Het
St6galnac1 T C 11: 116,660,010 (GRCm39) K101R probably benign Het
Stat1 C A 1: 52,191,530 (GRCm39) N628K probably benign Het
Syn2 A T 6: 115,231,615 (GRCm39) Y302F probably benign Het
Tapt1 T G 5: 44,345,978 (GRCm39) Q324P probably damaging Het
Tgoln1 C T 6: 72,593,403 (GRCm39) A26T unknown Het
Timm13 T A 10: 80,736,378 (GRCm39) T43S probably benign Het
Tnfrsf19 G A 14: 61,242,654 (GRCm39) P77S possibly damaging Het
Trem3 T G 17: 48,564,969 (GRCm39) F157V probably benign Het
Trgv3 T A 13: 19,427,016 (GRCm39) M1K probably null Het
Trim33 T A 3: 103,233,464 (GRCm39) S420T probably benign Het
Trip11 T C 12: 101,851,694 (GRCm39) K790R probably damaging Het
Trnt1 A G 6: 106,755,865 (GRCm39) T307A probably benign Het
Tshz1 T C 18: 84,033,766 (GRCm39) Y214C probably damaging Het
Vmn2r105 T A 17: 20,448,827 (GRCm39) T117S probably benign Het
Vmn2r45 A G 7: 8,484,342 (GRCm39) Y488H probably benign Het
Vwa8 A T 14: 79,320,254 (GRCm39) K1088N probably benign Het
Wdr35 T C 12: 9,036,000 (GRCm39) V257A probably benign Het
Zfp189 T A 4: 49,521,569 (GRCm39) S3T probably benign Het
Zscan22 G A 7: 12,640,833 (GRCm39) C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,251,812 (GRCm39) R283* probably null Het
Other mutations in Rgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Rgs1 APN 1 144,121,116 (GRCm39) missense probably damaging 1.00
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0106:Rgs1 UTSW 1 144,124,287 (GRCm39) missense probably benign 0.31
R0149:Rgs1 UTSW 1 144,124,825 (GRCm39) start gained probably benign
R0295:Rgs1 UTSW 1 144,121,224 (GRCm39) missense probably damaging 1.00
R0833:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R0836:Rgs1 UTSW 1 144,123,671 (GRCm39) missense probably damaging 1.00
R1585:Rgs1 UTSW 1 144,121,227 (GRCm39) critical splice acceptor site probably null
R4373:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4375:Rgs1 UTSW 1 144,123,644 (GRCm39) missense probably benign 0.00
R4769:Rgs1 UTSW 1 144,123,667 (GRCm39) missense probably damaging 1.00
R4961:Rgs1 UTSW 1 144,124,309 (GRCm39) splice site probably null
R4992:Rgs1 UTSW 1 144,122,060 (GRCm39) missense probably damaging 1.00
R5427:Rgs1 UTSW 1 144,122,018 (GRCm39) nonsense probably null
R5614:Rgs1 UTSW 1 144,121,995 (GRCm39) missense probably benign 0.18
R5743:Rgs1 UTSW 1 144,121,110 (GRCm39) missense probably damaging 1.00
R7315:Rgs1 UTSW 1 144,124,637 (GRCm39) critical splice donor site probably null
R7633:Rgs1 UTSW 1 144,124,215 (GRCm39) critical splice donor site probably null
R9640:Rgs1 UTSW 1 144,121,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTGTACTTCCACTGGGC -3'
(R):5'- ACTGGCTTAGAACACCAATTCAG -3'

Sequencing Primer
(F):5'- ACCCAAGTAGGCCAGGTTG -3'
(R):5'- ACCATTTTAAGATGATTCTGGAACAC -3'
Posted On 2019-10-17