Incidental Mutation 'R7491:Scn2a'
ID 580727
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission 045565-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7491 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65532352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 655 (S655P)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: S655P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: S655P

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: S655P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: S655P

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: S655P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: S655P

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,445,099 (GRCm39) probably null Het
5730522E02Rik A T 11: 25,719,014 (GRCm39) V44E unknown Het
Adcy9 A G 16: 4,236,673 (GRCm39) L246S possibly damaging Het
Adk C T 14: 21,284,997 (GRCm39) H123Y probably damaging Het
Adra1b T A 11: 43,726,794 (GRCm39) D41V probably benign Het
Ankib1 T G 5: 3,751,911 (GRCm39) K710Q probably damaging Het
Aoc2 T A 11: 101,219,203 (GRCm39) V542D probably benign Het
Arhgef28 T C 13: 98,081,194 (GRCm39) N1221S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,795,450 (GRCm39) probably benign Het
Bmal1 T C 7: 112,898,631 (GRCm39) V353A probably benign Het
Cacna1a C A 8: 85,285,922 (GRCm39) R856S possibly damaging Het
Cacna1c T C 6: 118,590,304 (GRCm39) M1559V Het
Cdh10 G C 15: 19,013,445 (GRCm39) E682Q probably damaging Het
Celsr1 T C 15: 85,916,719 (GRCm39) D418G possibly damaging Het
Cfap44 T C 16: 44,291,111 (GRCm39) L1537P probably damaging Het
Clca3a2 A G 3: 144,519,340 (GRCm39) S279P probably damaging Het
Col2a1 C T 15: 97,874,040 (GRCm39) V1449I not run Het
Cpt2 A G 4: 107,764,339 (GRCm39) F475S probably damaging Het
Cpxm1 T C 2: 130,235,487 (GRCm39) T502A probably benign Het
Creb3l2 G T 6: 37,356,794 (GRCm39) T91N probably benign Het
D630045J12Rik A T 6: 38,119,601 (GRCm39) S1714T possibly damaging Het
Dennd1c C A 17: 57,379,379 (GRCm39) V246F probably damaging Het
Dse A G 10: 34,028,561 (GRCm39) V843A probably benign Het
Ern2 C A 7: 121,769,756 (GRCm39) W810L probably damaging Het
Fer1l6 G A 15: 58,472,281 (GRCm39) D906N probably damaging Het
Fry A G 5: 150,389,791 (GRCm39) E140G Het
Galnt7 A G 8: 58,005,552 (GRCm39) V227A probably damaging Het
Gas2l3 A G 10: 89,249,763 (GRCm39) S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gm826 A T 2: 160,153,942 (GRCm39) S34T unknown Het
Gzmk A T 13: 113,308,535 (GRCm39) I222N probably benign Het
Hivep3 A T 4: 119,956,027 (GRCm39) T1448S probably benign Het
Hk1 T C 10: 62,131,524 (GRCm39) D278G probably damaging Het
Ipo7 C A 7: 109,638,401 (GRCm39) Q223K possibly damaging Het
Itga9 T A 9: 118,598,179 (GRCm39) I571N probably damaging Het
Itgb6 T C 2: 60,450,720 (GRCm39) Y573C probably damaging Het
Kmt2c T A 5: 25,489,562 (GRCm39) H4459L probably damaging Het
Limch1 T G 5: 67,211,580 (GRCm39) S894R probably damaging Het
Lrit2 A T 14: 36,790,867 (GRCm39) Q182L possibly damaging Het
Mlph A T 1: 90,867,100 (GRCm39) H374L possibly damaging Het
Mmrn2 A G 14: 34,121,374 (GRCm39) H748R probably damaging Het
Mrpl58 T C 11: 115,301,092 (GRCm39) V134A possibly damaging Het
Nae1 A T 8: 105,244,871 (GRCm39) D353E probably benign Het
Naip5 A C 13: 100,353,579 (GRCm39) F1227V probably benign Het
Nln A T 13: 104,205,831 (GRCm39) F108I probably damaging Het
Nop16 C T 13: 54,736,417 (GRCm39) V94I probably benign Het
Nt5c1b A T 12: 10,424,903 (GRCm39) T150S probably benign Het
Or10d4b T G 9: 39,535,268 (GRCm39) I281S possibly damaging Het
Pcdha4 T C 18: 37,087,689 (GRCm39) V624A probably damaging Het
Pcdhga8 T C 18: 37,860,483 (GRCm39) I513T probably benign Het
Prc1 A T 7: 79,959,239 (GRCm39) probably null Het
Prpf4 T A 4: 62,336,113 (GRCm39) F280Y probably damaging Het
Ptprd T C 4: 76,051,392 (GRCm39) E43G probably benign Het
Pum1 T A 4: 130,446,485 (GRCm39) D181E probably benign Het
Rab7 A G 6: 87,990,624 (GRCm39) S17P probably damaging Het
Rgs1 T C 1: 144,121,134 (GRCm39) Y179C probably damaging Het
Rrm1 T C 7: 102,103,764 (GRCm39) C238R probably damaging Het
Rusc2 T A 4: 43,426,528 (GRCm39) L1484Q probably damaging Het
Sall3 C T 18: 81,015,920 (GRCm39) M669I probably benign Het
Saxo1 A C 4: 86,363,644 (GRCm39) F280V probably benign Het
Senp6 G T 9: 80,031,010 (GRCm39) E571* probably null Het
Sin3b C G 8: 73,473,069 (GRCm39) T463S probably damaging Het
Sirt7 C A 11: 120,509,837 (GRCm39) R349L probably benign Het
Skor1 T C 9: 63,053,730 (GRCm39) T80A probably damaging Het
Slc12a9 C A 5: 137,321,082 (GRCm39) A478S probably damaging Het
Slc25a23 T A 17: 57,359,822 (GRCm39) R310* probably null Het
Slco6c1 A T 1: 97,055,579 (GRCm39) H107Q probably benign Het
Slit2 A G 5: 48,377,336 (GRCm39) E455G probably benign Het
Smo G C 6: 29,736,119 (GRCm39) G37A probably damaging Het
St6galnac1 T C 11: 116,660,010 (GRCm39) K101R probably benign Het
Stat1 C A 1: 52,191,530 (GRCm39) N628K probably benign Het
Syn2 A T 6: 115,231,615 (GRCm39) Y302F probably benign Het
Tapt1 T G 5: 44,345,978 (GRCm39) Q324P probably damaging Het
Tgoln1 C T 6: 72,593,403 (GRCm39) A26T unknown Het
Timm13 T A 10: 80,736,378 (GRCm39) T43S probably benign Het
Tnfrsf19 G A 14: 61,242,654 (GRCm39) P77S possibly damaging Het
Trem3 T G 17: 48,564,969 (GRCm39) F157V probably benign Het
Trgv3 T A 13: 19,427,016 (GRCm39) M1K probably null Het
Trim33 T A 3: 103,233,464 (GRCm39) S420T probably benign Het
Trip11 T C 12: 101,851,694 (GRCm39) K790R probably damaging Het
Trnt1 A G 6: 106,755,865 (GRCm39) T307A probably benign Het
Tshz1 T C 18: 84,033,766 (GRCm39) Y214C probably damaging Het
Vmn2r105 T A 17: 20,448,827 (GRCm39) T117S probably benign Het
Vmn2r45 A G 7: 8,484,342 (GRCm39) Y488H probably benign Het
Vwa8 A T 14: 79,320,254 (GRCm39) K1088N probably benign Het
Wdr35 T C 12: 9,036,000 (GRCm39) V257A probably benign Het
Zfp189 T A 4: 49,521,569 (GRCm39) S3T probably benign Het
Zscan22 G A 7: 12,640,833 (GRCm39) C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,251,812 (GRCm39) R283* probably null Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7069:Scn2a UTSW 2 65,594,950 (GRCm39) missense probably benign 0.00
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTTCAAAGGTCGGGTGAAGG -3'
(R):5'- TTGGCCTGGGAATAAAAGATGC -3'

Sequencing Primer
(F):5'- CTTTGCGGACGATGAACAC -3'
(R):5'- AGATGCAGGAAAATTATCATCTGTG -3'
Posted On 2019-10-17