Incidental Mutation 'R7491:Scn2a'
ID 580727
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Scn2a1, Nav1.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7491 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 65620771-65767447 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65702008 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 655 (S655P)
Ref Sequence ENSEMBL: ENSMUSP00000028377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably damaging
Transcript: ENSMUST00000028377
AA Change: S655P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: S655P

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100067
AA Change: S655P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: S655P

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200829
AA Change: S655P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: S655P

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,614,755 probably null Het
5730522E02Rik A T 11: 25,769,014 V44E unknown Het
Adcy9 A G 16: 4,418,809 L246S possibly damaging Het
Adk C T 14: 21,234,929 H123Y probably damaging Het
Adra1b T A 11: 43,835,967 D41V probably benign Het
Ankib1 T G 5: 3,701,911 K710Q probably damaging Het
Aoc2 T A 11: 101,328,377 V542D probably benign Het
Arhgef28 T C 13: 97,944,686 N1221S probably benign Het
Arntl T C 7: 113,299,424 V353A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
Cacna1a C A 8: 84,559,293 R856S possibly damaging Het
Cacna1c T C 6: 118,613,343 M1559V Het
Cdh10 G C 15: 19,013,359 E682Q probably damaging Het
Celsr1 T C 15: 86,032,518 D418G possibly damaging Het
Cfap44 T C 16: 44,470,748 L1537P probably damaging Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Col2a1 C T 15: 97,976,159 V1449I not run Het
Cpt2 A G 4: 107,907,142 F475S probably damaging Het
Cpxm1 T C 2: 130,393,567 T502A probably benign Het
Creb3l2 G T 6: 37,379,859 T91N probably benign Het
D630045J12Rik A T 6: 38,142,666 S1714T possibly damaging Het
Dennd1c C A 17: 57,072,379 V246F probably damaging Het
Dse A G 10: 34,152,565 V843A probably benign Het
Ern2 C A 7: 122,170,533 W810L probably damaging Het
Fer1l6 G A 15: 58,600,432 D906N probably damaging Het
Fry A G 5: 150,466,326 E140G Het
Galnt7 A G 8: 57,552,518 V227A probably damaging Het
Gas2l3 A G 10: 89,413,901 S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm826 A T 2: 160,312,022 S34T unknown Het
Gzmk A T 13: 113,172,001 I222N probably benign Het
Hivep3 A T 4: 120,098,830 T1448S probably benign Het
Hk1 T C 10: 62,295,745 D278G probably damaging Het
Ipo7 C A 7: 110,039,194 Q223K possibly damaging Het
Itga9 T A 9: 118,769,111 I571N probably damaging Het
Itgb6 T C 2: 60,620,376 Y573C probably damaging Het
Kmt2c T A 5: 25,284,564 H4459L probably damaging Het
Limch1 T G 5: 67,054,237 S894R probably damaging Het
Lrit2 A T 14: 37,068,910 Q182L possibly damaging Het
Mlph A T 1: 90,939,378 H374L possibly damaging Het
Mmrn2 A G 14: 34,399,417 H748R probably damaging Het
Mrpl58 T C 11: 115,410,266 V134A possibly damaging Het
Nae1 A T 8: 104,518,239 D353E probably benign Het
Naip5 A C 13: 100,217,071 F1227V probably benign Het
Nln A T 13: 104,069,323 F108I probably damaging Het
Nop16 C T 13: 54,588,604 V94I probably benign Het
Nt5c1b A T 12: 10,374,903 T150S probably benign Het
Olfr960 T G 9: 39,623,972 I281S possibly damaging Het
Pcdha4 T C 18: 36,954,636 V624A probably damaging Het
Pcdhga8 T C 18: 37,727,430 I513T probably benign Het
Prc1 A T 7: 80,309,491 probably null Het
Prpf4 T A 4: 62,417,876 F280Y probably damaging Het
Ptprd T C 4: 76,133,155 E43G probably benign Het
Pum1 T A 4: 130,719,174 D181E probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Rgs1 T C 1: 144,245,396 Y179C probably damaging Het
Rrm1 T C 7: 102,454,557 C238R probably damaging Het
Rusc2 T A 4: 43,426,528 L1484Q probably damaging Het
Sall3 C T 18: 80,972,705 M669I probably benign Het
Saxo1 A C 4: 86,445,407 F280V probably benign Het
Senp6 G T 9: 80,123,728 E571* probably null Het
Sin3b C G 8: 72,746,441 T463S probably damaging Het
Sirt7 C A 11: 120,619,011 R349L probably benign Het
Skor1 T C 9: 63,146,448 T80A probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc25a23 T A 17: 57,052,822 R310* probably null Het
Slco6c1 A T 1: 97,127,854 H107Q probably benign Het
Slit2 A G 5: 48,219,994 E455G probably benign Het
Smo G C 6: 29,736,120 G37A probably damaging Het
St6galnac1 T C 11: 116,769,184 K101R probably benign Het
Stat1 C A 1: 52,152,371 N628K probably benign Het
Syn2 A T 6: 115,254,654 Y302F probably benign Het
Tapt1 T G 5: 44,188,636 Q324P probably damaging Het
Tcrg-V3 T A 13: 19,242,846 M1K probably null Het
Tgoln1 C T 6: 72,616,420 A26T unknown Het
Timm13 T A 10: 80,900,544 T43S probably benign Het
Tnfrsf19 G A 14: 61,005,205 P77S possibly damaging Het
Trem3 T G 17: 48,257,941 F157V probably benign Het
Trim33 T A 3: 103,326,148 S420T probably benign Het
Trip11 T C 12: 101,885,435 K790R probably damaging Het
Trnt1 A G 6: 106,778,904 T307A probably benign Het
Tshz1 T C 18: 84,015,641 Y214C probably damaging Het
Vmn2r105 T A 17: 20,228,565 T117S probably benign Het
Vmn2r45 A G 7: 8,481,343 Y488H probably benign Het
Vwa8 A T 14: 79,082,814 K1088N probably benign Het
Wdr35 T C 12: 8,986,000 V257A probably benign Het
Zfp189 T A 4: 49,521,569 S3T probably benign Het
Zscan22 G A 7: 12,906,906 C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,517,885 R283* probably null Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65764440 missense probably benign
IGL00159:Scn2a APN 2 65743090 missense probably damaging 1.00
IGL00418:Scn2a APN 2 65764522 missense probably benign 0.43
IGL00753:Scn2a APN 2 65683863 missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00774:Scn2a APN 2 65735853 missense probably damaging 1.00
IGL00847:Scn2a APN 2 65670734 missense probably damaging 1.00
IGL01155:Scn2a APN 2 65717748 missense probably damaging 1.00
IGL01329:Scn2a APN 2 65717508 missense probably benign 0.05
IGL01537:Scn2a APN 2 65715875 missense probably benign 0.00
IGL01672:Scn2a APN 2 65751934 missense probably damaging 1.00
IGL01958:Scn2a APN 2 65701829 missense probably damaging 1.00
IGL02028:Scn2a APN 2 65763658 missense probably damaging 0.96
IGL02142:Scn2a APN 2 65715838 missense probably damaging 1.00
IGL02160:Scn2a APN 2 65730116 missense probably damaging 1.00
IGL02183:Scn2a APN 2 65671603 missense probably benign 0.20
IGL02341:Scn2a APN 2 65688377 missense probably damaging 1.00
IGL02504:Scn2a APN 2 65683884 missense probably benign 0.02
IGL02530:Scn2a APN 2 65730178 missense probably damaging 0.99
IGL02621:Scn2a APN 2 65748879 splice site probably benign
IGL02652:Scn2a APN 2 65702038 missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65701844 missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65671653 missense probably damaging 0.99
IGL03329:Scn2a APN 2 65764629 missense probably benign
IGL03336:Scn2a APN 2 65688744 missense probably damaging 1.00
IGL03391:Scn2a APN 2 65764213 missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65715730 missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65683838 missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65711908 missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65688419 missense probably damaging 1.00
R0021:Scn2a UTSW 2 65670515 missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65711816 missense probably benign 0.01
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0240:Scn2a UTSW 2 65735774 missense probably benign 0.32
R0335:Scn2a UTSW 2 65682091 missense probably damaging 1.00
R0508:Scn2a UTSW 2 65717842 missense probably damaging 0.99
R0558:Scn2a UTSW 2 65711925 missense probably benign 0.26
R0600:Scn2a UTSW 2 65701833 missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65751996 missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65686779 splice site probably benign
R1244:Scn2a UTSW 2 65763655 missense probably damaging 0.98
R1386:Scn2a UTSW 2 65688741 missense probably damaging 1.00
R1434:Scn2a UTSW 2 65701991 missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65764594 missense probably benign
R1448:Scn2a UTSW 2 65683845 missense probably benign 0.17
R1460:Scn2a UTSW 2 65701843 missense probably damaging 0.96
R1553:Scn2a UTSW 2 65713836 nonsense probably null
R1642:Scn2a UTSW 2 65683697 missense probably damaging 1.00
R1803:Scn2a UTSW 2 65670767 splice site probably null
R1981:Scn2a UTSW 2 65690170 missense probably damaging 1.00
R2002:Scn2a UTSW 2 65682083 missense probably null 1.00
R2068:Scn2a UTSW 2 65752073 missense probably benign 0.14
R2125:Scn2a UTSW 2 65752079 nonsense probably null
R2126:Scn2a UTSW 2 65752079 nonsense probably null
R2876:Scn2a UTSW 2 65715897 missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65688371 missense probably damaging 1.00
R3113:Scn2a UTSW 2 65748785 missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3750:Scn2a UTSW 2 65713771 missense probably damaging 1.00
R3765:Scn2a UTSW 2 65682710 missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65682031 missense probably benign 0.14
R4585:Scn2a UTSW 2 65743051 splice site probably null
R4586:Scn2a UTSW 2 65743051 splice site probably null
R4588:Scn2a UTSW 2 65713767 missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65752027 missense probably benign 0.04
R5108:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R5161:Scn2a UTSW 2 65764591 missense probably benign 0.00
R5235:Scn2a UTSW 2 65752011 missense probably damaging 1.00
R5464:Scn2a UTSW 2 65701756 missense probably damaging 1.00
R5586:Scn2a UTSW 2 65707295 nonsense probably null
R5630:Scn2a UTSW 2 65726365 missense probably damaging 1.00
R5715:Scn2a UTSW 2 65717584 missense probably benign 0.27
R5730:Scn2a UTSW 2 65682538 nonsense probably null
R5734:Scn2a UTSW 2 65717722 missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65764483 missense probably benign 0.00
R6133:Scn2a UTSW 2 65743104 missense probably benign 0.35
R6547:Scn2a UTSW 2 65715897 missense probably benign 0.29
R6549:Scn2a UTSW 2 65764674 missense probably benign 0.05
R6818:Scn2a UTSW 2 65688669 nonsense probably null
R6999:Scn2a UTSW 2 65682109 missense probably benign
R7069:Scn2a UTSW 2 65764606 missense probably benign 0.00
R7073:Scn2a UTSW 2 65728443 missense probably benign 0.00
R7125:Scn2a UTSW 2 65763933 missense probably damaging 1.00
R7178:Scn2a UTSW 2 65748853 nonsense probably null
R7179:Scn2a UTSW 2 65701979 missense probably damaging 1.00
R7203:Scn2a UTSW 2 65748319 missense probably benign 0.01
R7227:Scn2a UTSW 2 65752023 missense probably damaging 0.98
R7269:Scn2a UTSW 2 65763769 missense probably damaging 1.00
R7358:Scn2a UTSW 2 65682506 nonsense probably null
R7388:Scn2a UTSW 2 65688654 missense probably damaging 1.00
R7619:Scn2a UTSW 2 65715903 missense probably damaging 1.00
R7695:Scn2a UTSW 2 65711907 missense probably damaging 0.99
R7735:Scn2a UTSW 2 65763669 missense probably benign 0.40
R7911:Scn2a UTSW 2 65682083 missense probably null 1.00
R8096:Scn2a UTSW 2 65764022 missense probably damaging 0.98
R8333:Scn2a UTSW 2 65683847 missense probably benign 0.01
R8416:Scn2a UTSW 2 65681001 missense probably benign 0.00
R8850:Scn2a UTSW 2 65688386 missense probably damaging 1.00
R8897:Scn2a UTSW 2 65715658 critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65763670 missense probably damaging 0.99
R8992:Scn2a UTSW 2 65763898 missense probably damaging 1.00
R9190:Scn2a UTSW 2 65681002 missense probably benign 0.00
R9206:Scn2a UTSW 2 65717787 missense probably damaging 1.00
R9355:Scn2a UTSW 2 65764089 missense probably damaging 1.00
R9452:Scn2a UTSW 2 65764819 missense probably benign
R9529:Scn2a UTSW 2 65764588 missense probably damaging 0.99
R9567:Scn2a UTSW 2 65688630 missense probably damaging 1.00
R9569:Scn2a UTSW 2 65730278 missense probably damaging 1.00
R9657:Scn2a UTSW 2 65735688 missense probably damaging 1.00
R9715:Scn2a UTSW 2 65748805 missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65735686 missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65751868 missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65717735 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTTCAAAGGTCGGGTGAAGG -3'
(R):5'- TTGGCCTGGGAATAAAAGATGC -3'

Sequencing Primer
(F):5'- CTTTGCGGACGATGAACAC -3'
(R):5'- AGATGCAGGAAAATTATCATCTGTG -3'
Posted On 2019-10-17