Incidental Mutation 'R7491:BC028528'
ID580730
Institutional Source Beutler Lab
Gene Symbol BC028528
Ensembl Gene ENSMUSG00000038543
Gene NamecDNA sequence BC028528
SynonymsL259
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7491 (G1)
Quality Score214.458
Status Not validated
Chromosome3
Chromosomal Location95883954-95892005 bp(-) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT at 95888136 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036360] [ENSMUST00000090476] [ENSMUST00000171519]
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,614,755 probably null Het
5730522E02Rik A T 11: 25,769,014 V44E unknown Het
Adcy9 A G 16: 4,418,809 L246S possibly damaging Het
Adk C T 14: 21,234,929 H123Y probably damaging Het
Adra1b T A 11: 43,835,967 D41V probably benign Het
Ankib1 T G 5: 3,701,911 K710Q probably damaging Het
Aoc2 T A 11: 101,328,377 V542D probably benign Het
Arhgef28 T C 13: 97,944,686 N1221S probably benign Het
Arntl T C 7: 113,299,424 V353A probably benign Het
Cacna1a C A 8: 84,559,293 R856S possibly damaging Het
Cacna1c T C 6: 118,613,343 M1559V Het
Cdh10 G C 15: 19,013,359 E682Q probably damaging Het
Celsr1 T C 15: 86,032,518 D418G possibly damaging Het
Cfap44 T C 16: 44,470,748 L1537P probably damaging Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Col2a1 C T 15: 97,976,159 V1449I not run Het
Cpt2 A G 4: 107,907,142 F475S probably damaging Het
Cpxm1 T C 2: 130,393,567 T502A probably benign Het
Creb3l2 G T 6: 37,379,859 T91N probably benign Het
D630045J12Rik A T 6: 38,142,666 S1714T possibly damaging Het
Dennd1c C A 17: 57,072,379 V246F probably damaging Het
Dse A G 10: 34,152,565 V843A probably benign Het
Ern2 C A 7: 122,170,533 W810L probably damaging Het
Fer1l6 G A 15: 58,600,432 D906N probably damaging Het
Fry A G 5: 150,466,326 E140G Het
Galnt7 A G 8: 57,552,518 V227A probably damaging Het
Gas2l3 A G 10: 89,413,901 S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm826 A T 2: 160,312,022 S34T unknown Het
Gzmk A T 13: 113,172,001 I222N probably benign Het
Hivep3 A T 4: 120,098,830 T1448S probably benign Het
Hk1 T C 10: 62,295,745 D278G probably damaging Het
Ipo7 C A 7: 110,039,194 Q223K possibly damaging Het
Itga9 T A 9: 118,769,111 I571N probably damaging Het
Itgb6 T C 2: 60,620,376 Y573C probably damaging Het
Kmt2c T A 5: 25,284,564 H4459L probably damaging Het
Limch1 T G 5: 67,054,237 S894R probably damaging Het
Lrit2 A T 14: 37,068,910 Q182L possibly damaging Het
Mlph A T 1: 90,939,378 H374L possibly damaging Het
Mmrn2 A G 14: 34,399,417 H748R probably damaging Het
Mrpl58 T C 11: 115,410,266 V134A possibly damaging Het
Nae1 A T 8: 104,518,239 D353E probably benign Het
Naip5 A C 13: 100,217,071 F1227V probably benign Het
Nln A T 13: 104,069,323 F108I probably damaging Het
Nop16 C T 13: 54,588,604 V94I probably benign Het
Nt5c1b A T 12: 10,374,903 T150S probably benign Het
Olfr960 T G 9: 39,623,972 I281S possibly damaging Het
Pcdha4 T C 18: 36,954,636 V624A probably damaging Het
Pcdhga8 T C 18: 37,727,430 I513T probably benign Het
Prc1 A T 7: 80,309,491 probably null Het
Prpf4 T A 4: 62,417,876 F280Y probably damaging Het
Ptprd T C 4: 76,133,155 E43G probably benign Het
Pum1 T A 4: 130,719,174 D181E probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Rgs1 T C 1: 144,245,396 Y179C probably damaging Het
Rrm1 T C 7: 102,454,557 C238R probably damaging Het
Rusc2 T A 4: 43,426,528 L1484Q probably damaging Het
Sall3 C T 18: 80,972,705 M669I probably benign Het
Saxo1 A C 4: 86,445,407 F280V probably benign Het
Scn2a T C 2: 65,702,008 S655P probably damaging Het
Senp6 G T 9: 80,123,728 E571* probably null Het
Sin3b C G 8: 72,746,441 T463S probably damaging Het
Sirt7 C A 11: 120,619,011 R349L probably benign Het
Skor1 T C 9: 63,146,448 T80A probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc25a23 T A 17: 57,052,822 R310* probably null Het
Slco6c1 A T 1: 97,127,854 H107Q probably benign Het
Slit2 A G 5: 48,219,994 E455G probably benign Het
Smo G C 6: 29,736,120 G37A probably damaging Het
St6galnac1 T C 11: 116,769,184 K101R probably benign Het
Stat1 C A 1: 52,152,371 N628K probably benign Het
Syn2 A T 6: 115,254,654 Y302F probably benign Het
Tapt1 T G 5: 44,188,636 Q324P probably damaging Het
Tcrg-V3 T A 13: 19,242,846 M1K probably null Het
Tgoln1 C T 6: 72,616,420 A26T unknown Het
Timm13 T A 10: 80,900,544 T43S probably benign Het
Tnfrsf19 G A 14: 61,005,205 P77S possibly damaging Het
Trem3 T G 17: 48,257,941 F157V probably benign Het
Trim33 T A 3: 103,326,148 S420T probably benign Het
Trip11 T C 12: 101,885,435 K790R probably damaging Het
Trnt1 A G 6: 106,778,904 T307A probably benign Het
Tshz1 T C 18: 84,015,641 Y214C probably damaging Het
Vmn2r105 T A 17: 20,228,565 T117S probably benign Het
Vmn2r45 A G 7: 8,481,343 Y488H probably benign Het
Vwa8 A T 14: 79,082,814 K1088N probably benign Het
Wdr35 T C 12: 8,986,000 V257A probably benign Het
Zfp189 T A 4: 49,521,569 S3T probably benign Het
Zscan22 G A 7: 12,906,906 C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,517,885 R283* probably null Het
Other mutations in BC028528
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:BC028528 APN 3 95888900 missense probably damaging 1.00
R0157:BC028528 UTSW 3 95884968 critical splice donor site probably null
R0164:BC028528 UTSW 3 95887334 intron probably benign
R0306:BC028528 UTSW 3 95889820 unclassified probably benign
R1478:BC028528 UTSW 3 95891959 unclassified probably null
R4204:BC028528 UTSW 3 95889745 nonsense probably null
R4649:BC028528 UTSW 3 95888265 missense probably damaging 0.99
R5022:BC028528 UTSW 3 95888823 intron probably benign
R6541:BC028528 UTSW 3 95888218 missense probably benign 0.00
R6683:BC028528 UTSW 3 95888227 missense probably damaging 1.00
R6980:BC028528 UTSW 3 95888136 small insertion probably benign
R6980:BC028528 UTSW 3 95888139 small insertion probably benign
R6980:BC028528 UTSW 3 95888168 small insertion probably benign
R7058:BC028528 UTSW 3 95885011 missense possibly damaging 0.84
R7180:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888136 small insertion probably benign
R7308:BC028528 UTSW 3 95888152 small insertion probably benign
R7308:BC028528 UTSW 3 95888169 small insertion probably benign
R7310:BC028528 UTSW 3 95888136 small insertion probably benign
R7310:BC028528 UTSW 3 95888139 small insertion probably benign
R7310:BC028528 UTSW 3 95888148 small insertion probably benign
R7310:BC028528 UTSW 3 95888173 small insertion probably benign
R7356:BC028528 UTSW 3 95888136 small insertion probably benign
R7356:BC028528 UTSW 3 95888141 small insertion probably benign
R7356:BC028528 UTSW 3 95888158 small insertion probably benign
R7356:BC028528 UTSW 3 95888165 small insertion probably benign
R7356:BC028528 UTSW 3 95888175 small insertion probably benign
R7356:BC028528 UTSW 3 95888183 small insertion probably benign
R7376:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888136 small insertion probably benign
R7430:BC028528 UTSW 3 95888169 small insertion probably benign
R7490:BC028528 UTSW 3 95888136 small insertion probably benign
R7490:BC028528 UTSW 3 95888166 small insertion probably benign
R7490:BC028528 UTSW 3 95888186 small insertion probably benign
R7491:BC028528 UTSW 3 95888138 small insertion probably benign
R7496:BC028528 UTSW 3 95888177 small insertion probably benign
R7497:BC028528 UTSW 3 95888136 small insertion probably benign
R7497:BC028528 UTSW 3 95888171 small insertion probably benign
R7498:BC028528 UTSW 3 95888136 small insertion probably benign
R7498:BC028528 UTSW 3 95888182 small insertion probably benign
R7552:BC028528 UTSW 3 95888169 small insertion probably benign
R7565:BC028528 UTSW 3 95888136 small insertion probably benign
R7565:BC028528 UTSW 3 95888138 small insertion probably benign
R7565:BC028528 UTSW 3 95888144 small insertion probably benign
R7566:BC028528 UTSW 3 95888136 small insertion probably benign
R7566:BC028528 UTSW 3 95888145 small insertion probably benign
R7568:BC028528 UTSW 3 95888136 small insertion probably benign
R7568:BC028528 UTSW 3 95888151 small insertion probably benign
R7568:BC028528 UTSW 3 95888172 small insertion probably benign
R7569:BC028528 UTSW 3 95888136 small insertion probably benign
R7580:BC028528 UTSW 3 95888136 small insertion probably benign
R7580:BC028528 UTSW 3 95888140 small insertion probably benign
R7635:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888136 small insertion probably benign
R7672:BC028528 UTSW 3 95888143 small insertion probably benign
R7672:BC028528 UTSW 3 95888175 small insertion probably benign
R7685:BC028528 UTSW 3 95888136 small insertion probably benign
R7685:BC028528 UTSW 3 95888153 small insertion probably benign
R7685:BC028528 UTSW 3 95888156 small insertion probably benign
R7685:BC028528 UTSW 3 95888183 nonsense probably null
R7686:BC028528 UTSW 3 95888136 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AAAGTTGTCCTCTGTCCTCAACAC -3'
(R):5'- AATCCTACCGAGGGCAGAACAG -3'

Sequencing Primer
(F):5'- CAATTGGAGAATTGCCTCTGTCAG -3'
(R):5'- CAGGTTGAATAAGGAGGTAACAAC -3'
Posted On2019-10-17