Incidental Mutation 'R7491:Rusc2'
ID580734
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7491 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43426528 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1484 (L1484Q)
Ref Sequence ENSEMBL: ENSMUSP00000038379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000171134] [ENSMUST00000173682]
Predicted Effect probably damaging
Transcript: ENSMUST00000035645
AA Change: L1484Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: L1484Q

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052829
SMART Domains Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 47 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098106
AA Change: L1484Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: L1484Q

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107928
SMART Domains Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.3e-20 PFAM
Pfam:DUF2475 212 251 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107929
SMART Domains Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.5e-20 PFAM
Pfam:DUF2475 232 271 7.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131668
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect probably benign
Transcript: ENSMUST00000149676
Predicted Effect probably benign
Transcript: ENSMUST00000155080
Predicted Effect probably benign
Transcript: ENSMUST00000171134
SMART Domains Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,614,755 probably null Het
5730522E02Rik A T 11: 25,769,014 V44E unknown Het
Adcy9 A G 16: 4,418,809 L246S possibly damaging Het
Adk C T 14: 21,234,929 H123Y probably damaging Het
Adra1b T A 11: 43,835,967 D41V probably benign Het
Ankib1 T G 5: 3,701,911 K710Q probably damaging Het
Aoc2 T A 11: 101,328,377 V542D probably benign Het
Arhgef28 T C 13: 97,944,686 N1221S probably benign Het
Arntl T C 7: 113,299,424 V353A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
Cacna1a C A 8: 84,559,293 R856S possibly damaging Het
Cacna1c T C 6: 118,613,343 M1559V Het
Cdh10 G C 15: 19,013,359 E682Q probably damaging Het
Celsr1 T C 15: 86,032,518 D418G possibly damaging Het
Cfap44 T C 16: 44,470,748 L1537P probably damaging Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Col2a1 C T 15: 97,976,159 V1449I not run Het
Cpt2 A G 4: 107,907,142 F475S probably damaging Het
Cpxm1 T C 2: 130,393,567 T502A probably benign Het
Creb3l2 G T 6: 37,379,859 T91N probably benign Het
D630045J12Rik A T 6: 38,142,666 S1714T possibly damaging Het
Dennd1c C A 17: 57,072,379 V246F probably damaging Het
Dse A G 10: 34,152,565 V843A probably benign Het
Ern2 C A 7: 122,170,533 W810L probably damaging Het
Fer1l6 G A 15: 58,600,432 D906N probably damaging Het
Fry A G 5: 150,466,326 E140G Het
Galnt7 A G 8: 57,552,518 V227A probably damaging Het
Gas2l3 A G 10: 89,413,901 S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm826 A T 2: 160,312,022 S34T unknown Het
Gzmk A T 13: 113,172,001 I222N probably benign Het
Hivep3 A T 4: 120,098,830 T1448S probably benign Het
Hk1 T C 10: 62,295,745 D278G probably damaging Het
Ipo7 C A 7: 110,039,194 Q223K possibly damaging Het
Itga9 T A 9: 118,769,111 I571N probably damaging Het
Itgb6 T C 2: 60,620,376 Y573C probably damaging Het
Kmt2c T A 5: 25,284,564 H4459L probably damaging Het
Limch1 T G 5: 67,054,237 S894R probably damaging Het
Lrit2 A T 14: 37,068,910 Q182L possibly damaging Het
Mlph A T 1: 90,939,378 H374L possibly damaging Het
Mmrn2 A G 14: 34,399,417 H748R probably damaging Het
Mrpl58 T C 11: 115,410,266 V134A possibly damaging Het
Nae1 A T 8: 104,518,239 D353E probably benign Het
Naip5 A C 13: 100,217,071 F1227V probably benign Het
Nln A T 13: 104,069,323 F108I probably damaging Het
Nop16 C T 13: 54,588,604 V94I probably benign Het
Nt5c1b A T 12: 10,374,903 T150S probably benign Het
Olfr960 T G 9: 39,623,972 I281S possibly damaging Het
Pcdha4 T C 18: 36,954,636 V624A probably damaging Het
Pcdhga8 T C 18: 37,727,430 I513T probably benign Het
Prc1 A T 7: 80,309,491 probably null Het
Prpf4 T A 4: 62,417,876 F280Y probably damaging Het
Ptprd T C 4: 76,133,155 E43G probably benign Het
Pum1 T A 4: 130,719,174 D181E probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Rgs1 T C 1: 144,245,396 Y179C probably damaging Het
Rrm1 T C 7: 102,454,557 C238R probably damaging Het
Sall3 C T 18: 80,972,705 M669I probably benign Het
Saxo1 A C 4: 86,445,407 F280V probably benign Het
Scn2a T C 2: 65,702,008 S655P probably damaging Het
Senp6 G T 9: 80,123,728 E571* probably null Het
Sin3b C G 8: 72,746,441 T463S probably damaging Het
Sirt7 C A 11: 120,619,011 R349L probably benign Het
Skor1 T C 9: 63,146,448 T80A probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc25a23 T A 17: 57,052,822 R310* probably null Het
Slco6c1 A T 1: 97,127,854 H107Q probably benign Het
Slit2 A G 5: 48,219,994 E455G probably benign Het
Smo G C 6: 29,736,120 G37A probably damaging Het
St6galnac1 T C 11: 116,769,184 K101R probably benign Het
Stat1 C A 1: 52,152,371 N628K probably benign Het
Syn2 A T 6: 115,254,654 Y302F probably benign Het
Tapt1 T G 5: 44,188,636 Q324P probably damaging Het
Tcrg-V3 T A 13: 19,242,846 M1K probably null Het
Tgoln1 C T 6: 72,616,420 A26T unknown Het
Timm13 T A 10: 80,900,544 T43S probably benign Het
Tnfrsf19 G A 14: 61,005,205 P77S possibly damaging Het
Trem3 T G 17: 48,257,941 F157V probably benign Het
Trim33 T A 3: 103,326,148 S420T probably benign Het
Trip11 T C 12: 101,885,435 K790R probably damaging Het
Trnt1 A G 6: 106,778,904 T307A probably benign Het
Tshz1 T C 18: 84,015,641 Y214C probably damaging Het
Vmn2r105 T A 17: 20,228,565 T117S probably benign Het
Vmn2r45 A G 7: 8,481,343 Y488H probably benign Het
Vwa8 A T 14: 79,082,814 K1088N probably benign Het
Wdr35 T C 12: 8,986,000 V257A probably benign Het
Zfp189 T A 4: 49,521,569 S3T probably benign Het
Zscan22 G A 7: 12,906,906 C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,517,885 R283* probably null Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 unclassified probably null
R5540:Rusc2 UTSW 4 43423975 missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGAACCTGCAAGAGTCAC -3'
(R):5'- TTTCATAGCCAAGCCTGAGGG -3'

Sequencing Primer
(F):5'- GTGCCCTCCAAACCTCCG -3'
(R):5'- CTTGGGAAGGACTCTTAGGCTC -3'
Posted On2019-10-17