Incidental Mutation 'R7491:Smo'
ID580749
Institutional Source Beutler Lab
Gene Symbol Smo
Ensembl Gene ENSMUSG00000001761
Gene Namesmoothened, frizzled class receptor
SynonymsE130215L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7491 (G1)
Quality Score195.009
Status Not validated
Chromosome6
Chromosomal Location29735503-29761365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 29736120 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 37 (G37A)
Ref Sequence ENSEMBL: ENSMUSP00000001812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001812]
Predicted Effect probably damaging
Transcript: ENSMUST00000001812
AA Change: G37A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000001812
Gene: ENSMUSG00000001761
AA Change: G37A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
FRI 73 187 5.48e-49 SMART
Frizzled 224 559 2.82e-148 SMART
low complexity region 641 652 N/A INTRINSIC
low complexity region 671 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010]
PHENOTYPE: Both an ENU-induced mutation and a null mutation are midgestation lethal. Observed defects include failure of neural tube closure and heart and gut defects. Conditional knockouts in chondrocytes and dental epithelium result in short long bones and dentalepithelium derivative defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,614,755 probably null Het
5730522E02Rik A T 11: 25,769,014 V44E unknown Het
Adcy9 A G 16: 4,418,809 L246S possibly damaging Het
Adk C T 14: 21,234,929 H123Y probably damaging Het
Adra1b T A 11: 43,835,967 D41V probably benign Het
Ankib1 T G 5: 3,701,911 K710Q probably damaging Het
Aoc2 T A 11: 101,328,377 V542D probably benign Het
Arhgef28 T C 13: 97,944,686 N1221S probably benign Het
Arntl T C 7: 113,299,424 V353A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
Cacna1a C A 8: 84,559,293 R856S possibly damaging Het
Cacna1c T C 6: 118,613,343 M1559V Het
Cdh10 G C 15: 19,013,359 E682Q probably damaging Het
Celsr1 T C 15: 86,032,518 D418G possibly damaging Het
Cfap44 T C 16: 44,470,748 L1537P probably damaging Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Col2a1 C T 15: 97,976,159 V1449I not run Het
Cpt2 A G 4: 107,907,142 F475S probably damaging Het
Cpxm1 T C 2: 130,393,567 T502A probably benign Het
Creb3l2 G T 6: 37,379,859 T91N probably benign Het
D630045J12Rik A T 6: 38,142,666 S1714T possibly damaging Het
Dennd1c C A 17: 57,072,379 V246F probably damaging Het
Dse A G 10: 34,152,565 V843A probably benign Het
Ern2 C A 7: 122,170,533 W810L probably damaging Het
Fer1l6 G A 15: 58,600,432 D906N probably damaging Het
Fry A G 5: 150,466,326 E140G Het
Galnt7 A G 8: 57,552,518 V227A probably damaging Het
Gas2l3 A G 10: 89,413,901 S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm826 A T 2: 160,312,022 S34T unknown Het
Gzmk A T 13: 113,172,001 I222N probably benign Het
Hivep3 A T 4: 120,098,830 T1448S probably benign Het
Hk1 T C 10: 62,295,745 D278G probably damaging Het
Ipo7 C A 7: 110,039,194 Q223K possibly damaging Het
Itga9 T A 9: 118,769,111 I571N probably damaging Het
Itgb6 T C 2: 60,620,376 Y573C probably damaging Het
Kmt2c T A 5: 25,284,564 H4459L probably damaging Het
Limch1 T G 5: 67,054,237 S894R probably damaging Het
Lrit2 A T 14: 37,068,910 Q182L possibly damaging Het
Mlph A T 1: 90,939,378 H374L possibly damaging Het
Mmrn2 A G 14: 34,399,417 H748R probably damaging Het
Mrpl58 T C 11: 115,410,266 V134A possibly damaging Het
Nae1 A T 8: 104,518,239 D353E probably benign Het
Naip5 A C 13: 100,217,071 F1227V probably benign Het
Nln A T 13: 104,069,323 F108I probably damaging Het
Nop16 C T 13: 54,588,604 V94I probably benign Het
Nt5c1b A T 12: 10,374,903 T150S probably benign Het
Olfr960 T G 9: 39,623,972 I281S possibly damaging Het
Pcdha4 T C 18: 36,954,636 V624A probably damaging Het
Pcdhga8 T C 18: 37,727,430 I513T probably benign Het
Prc1 A T 7: 80,309,491 probably null Het
Prpf4 T A 4: 62,417,876 F280Y probably damaging Het
Ptprd T C 4: 76,133,155 E43G probably benign Het
Pum1 T A 4: 130,719,174 D181E probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Rgs1 T C 1: 144,245,396 Y179C probably damaging Het
Rrm1 T C 7: 102,454,557 C238R probably damaging Het
Rusc2 T A 4: 43,426,528 L1484Q probably damaging Het
Sall3 C T 18: 80,972,705 M669I probably benign Het
Saxo1 A C 4: 86,445,407 F280V probably benign Het
Scn2a T C 2: 65,702,008 S655P probably damaging Het
Senp6 G T 9: 80,123,728 E571* probably null Het
Sin3b C G 8: 72,746,441 T463S probably damaging Het
Sirt7 C A 11: 120,619,011 R349L probably benign Het
Skor1 T C 9: 63,146,448 T80A probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc25a23 T A 17: 57,052,822 R310* probably null Het
Slco6c1 A T 1: 97,127,854 H107Q probably benign Het
Slit2 A G 5: 48,219,994 E455G probably benign Het
St6galnac1 T C 11: 116,769,184 K101R probably benign Het
Stat1 C A 1: 52,152,371 N628K probably benign Het
Syn2 A T 6: 115,254,654 Y302F probably benign Het
Tapt1 T G 5: 44,188,636 Q324P probably damaging Het
Tcrg-V3 T A 13: 19,242,846 M1K probably null Het
Tgoln1 C T 6: 72,616,420 A26T unknown Het
Timm13 T A 10: 80,900,544 T43S probably benign Het
Tnfrsf19 G A 14: 61,005,205 P77S possibly damaging Het
Trem3 T G 17: 48,257,941 F157V probably benign Het
Trim33 T A 3: 103,326,148 S420T probably benign Het
Trip11 T C 12: 101,885,435 K790R probably damaging Het
Trnt1 A G 6: 106,778,904 T307A probably benign Het
Tshz1 T C 18: 84,015,641 Y214C probably damaging Het
Vmn2r105 T A 17: 20,228,565 T117S probably benign Het
Vmn2r45 A G 7: 8,481,343 Y488H probably benign Het
Vwa8 A T 14: 79,082,814 K1088N probably benign Het
Wdr35 T C 12: 8,986,000 V257A probably benign Het
Zfp189 T A 4: 49,521,569 S3T probably benign Het
Zscan22 G A 7: 12,906,906 C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,517,885 R283* probably null Het
Other mutations in Smo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Smo APN 6 29758894 nonsense probably null
IGL01969:Smo APN 6 29755172 critical splice acceptor site probably null
IGL02078:Smo APN 6 29754708 missense possibly damaging 0.46
IGL02248:Smo APN 6 29757292 missense possibly damaging 0.69
IGL02496:Smo APN 6 29758481 missense probably damaging 0.99
IGL03159:Smo APN 6 29758505 missense probably benign 0.00
knobby UTSW 6 29736174 missense probably benign
R0548:Smo UTSW 6 29759586 missense possibly damaging 0.45
R0606:Smo UTSW 6 29753604 missense possibly damaging 0.69
R1164:Smo UTSW 6 29754719 missense probably benign 0.18
R1438:Smo UTSW 6 29755483 missense possibly damaging 0.89
R1900:Smo UTSW 6 29736056 missense unknown
R2022:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2023:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2129:Smo UTSW 6 29757314 missense probably damaging 1.00
R4033:Smo UTSW 6 29759918 missense probably damaging 0.98
R4795:Smo UTSW 6 29755574 missense probably damaging 0.99
R4878:Smo UTSW 6 29753571 missense probably benign 0.02
R4920:Smo UTSW 6 29759594 missense probably damaging 1.00
R5165:Smo UTSW 6 29736078 missense unknown
R5350:Smo UTSW 6 29754467 missense probably benign 0.02
R5554:Smo UTSW 6 29736124 missense possibly damaging 0.72
R6409:Smo UTSW 6 29736114 missense unknown
R6440:Smo UTSW 6 29756814 missense possibly damaging 0.93
R6707:Smo UTSW 6 29736174 missense probably benign
R6766:Smo UTSW 6 29736045 missense unknown
R7061:Smo UTSW 6 29760230 missense probably damaging 1.00
R7147:Smo UTSW 6 29758449 missense possibly damaging 0.91
R7500:Smo UTSW 6 29755535 missense probably benign 0.09
R7735:Smo UTSW 6 29759852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTGGCCCCAGACTTTC -3'
(R):5'- CAACAGTTTGAGGCCTGAGC -3'

Sequencing Primer
(F):5'- ACCGGTCGCCTAAGTAGC -3'
(R):5'- TTACCGGACCAGAGCACGAG -3'
Posted On2019-10-17