Incidental Mutation 'R7491:Arntl'
ID580762
Institutional Source Beutler Lab
Gene Symbol Arntl
Ensembl Gene ENSMUSG00000055116
Gene Namearyl hydrocarbon receptor nuclear translocator-like
SynonymsBmal1, MOP3, bHLHe5, Arnt3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.715) question?
Stock #R7491 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location113207465-113314126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113299424 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 353 (V353A)
Ref Sequence ENSEMBL: ENSMUSP00000046235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047321] [ENSMUST00000210074] [ENSMUST00000210238] [ENSMUST00000211770]
Predicted Effect probably benign
Transcript: ENSMUST00000047321
AA Change: V353A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046235
Gene: ENSMUSG00000055116
AA Change: V353A

DomainStartEndE-ValueType
HLH 78 131 2.92e-16 SMART
PAS 146 213 4.41e-12 SMART
PAS 328 394 1.66e-7 SMART
PAC 401 444 2.92e-3 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210074
AA Change: V340A

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000210238
AA Change: V353A

PolyPhen 2 Score 0.429 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000211770
AA Change: V360A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with Clock. This heterodimer binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Defects in this gene have been linked to infertility, problems with gluconeogenesis and lipogenesis, and altered sleep patterns. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in abnormal light/dark cycle activity and decreases overall activity levels. Mice homozygous for another knock-out allele exhibit loss of circadian rhythm in locomotor activity, dyslipidemia, ectopic fat formationand altered energy homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,614,755 probably null Het
5730522E02Rik A T 11: 25,769,014 V44E unknown Het
Adcy9 A G 16: 4,418,809 L246S possibly damaging Het
Adk C T 14: 21,234,929 H123Y probably damaging Het
Adra1b T A 11: 43,835,967 D41V probably benign Het
Ankib1 T G 5: 3,701,911 K710Q probably damaging Het
Aoc2 T A 11: 101,328,377 V542D probably benign Het
Arhgef28 T C 13: 97,944,686 N1221S probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
Cacna1a C A 8: 84,559,293 R856S possibly damaging Het
Cacna1c T C 6: 118,613,343 M1559V Het
Cdh10 G C 15: 19,013,359 E682Q probably damaging Het
Celsr1 T C 15: 86,032,518 D418G possibly damaging Het
Cfap44 T C 16: 44,470,748 L1537P probably damaging Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Col2a1 C T 15: 97,976,159 V1449I not run Het
Cpt2 A G 4: 107,907,142 F475S probably damaging Het
Cpxm1 T C 2: 130,393,567 T502A probably benign Het
Creb3l2 G T 6: 37,379,859 T91N probably benign Het
D630045J12Rik A T 6: 38,142,666 S1714T possibly damaging Het
Dennd1c C A 17: 57,072,379 V246F probably damaging Het
Dse A G 10: 34,152,565 V843A probably benign Het
Ern2 C A 7: 122,170,533 W810L probably damaging Het
Fer1l6 G A 15: 58,600,432 D906N probably damaging Het
Fry A G 5: 150,466,326 E140G Het
Galnt7 A G 8: 57,552,518 V227A probably damaging Het
Gas2l3 A G 10: 89,413,901 S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm826 A T 2: 160,312,022 S34T unknown Het
Gzmk A T 13: 113,172,001 I222N probably benign Het
Hivep3 A T 4: 120,098,830 T1448S probably benign Het
Hk1 T C 10: 62,295,745 D278G probably damaging Het
Ipo7 C A 7: 110,039,194 Q223K possibly damaging Het
Itga9 T A 9: 118,769,111 I571N probably damaging Het
Itgb6 T C 2: 60,620,376 Y573C probably damaging Het
Kmt2c T A 5: 25,284,564 H4459L probably damaging Het
Limch1 T G 5: 67,054,237 S894R probably damaging Het
Lrit2 A T 14: 37,068,910 Q182L possibly damaging Het
Mlph A T 1: 90,939,378 H374L possibly damaging Het
Mmrn2 A G 14: 34,399,417 H748R probably damaging Het
Mrpl58 T C 11: 115,410,266 V134A possibly damaging Het
Nae1 A T 8: 104,518,239 D353E probably benign Het
Naip5 A C 13: 100,217,071 F1227V probably benign Het
Nln A T 13: 104,069,323 F108I probably damaging Het
Nop16 C T 13: 54,588,604 V94I probably benign Het
Nt5c1b A T 12: 10,374,903 T150S probably benign Het
Olfr960 T G 9: 39,623,972 I281S possibly damaging Het
Pcdha4 T C 18: 36,954,636 V624A probably damaging Het
Pcdhga8 T C 18: 37,727,430 I513T probably benign Het
Prc1 A T 7: 80,309,491 probably null Het
Prpf4 T A 4: 62,417,876 F280Y probably damaging Het
Ptprd T C 4: 76,133,155 E43G probably benign Het
Pum1 T A 4: 130,719,174 D181E probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Rgs1 T C 1: 144,245,396 Y179C probably damaging Het
Rrm1 T C 7: 102,454,557 C238R probably damaging Het
Rusc2 T A 4: 43,426,528 L1484Q probably damaging Het
Sall3 C T 18: 80,972,705 M669I probably benign Het
Saxo1 A C 4: 86,445,407 F280V probably benign Het
Scn2a T C 2: 65,702,008 S655P probably damaging Het
Senp6 G T 9: 80,123,728 E571* probably null Het
Sin3b C G 8: 72,746,441 T463S probably damaging Het
Sirt7 C A 11: 120,619,011 R349L probably benign Het
Skor1 T C 9: 63,146,448 T80A probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc25a23 T A 17: 57,052,822 R310* probably null Het
Slco6c1 A T 1: 97,127,854 H107Q probably benign Het
Slit2 A G 5: 48,219,994 E455G probably benign Het
Smo G C 6: 29,736,120 G37A probably damaging Het
St6galnac1 T C 11: 116,769,184 K101R probably benign Het
Stat1 C A 1: 52,152,371 N628K probably benign Het
Syn2 A T 6: 115,254,654 Y302F probably benign Het
Tapt1 T G 5: 44,188,636 Q324P probably damaging Het
Tcrg-V3 T A 13: 19,242,846 M1K probably null Het
Tgoln1 C T 6: 72,616,420 A26T unknown Het
Timm13 T A 10: 80,900,544 T43S probably benign Het
Tnfrsf19 G A 14: 61,005,205 P77S possibly damaging Het
Trem3 T G 17: 48,257,941 F157V probably benign Het
Trim33 T A 3: 103,326,148 S420T probably benign Het
Trip11 T C 12: 101,885,435 K790R probably damaging Het
Trnt1 A G 6: 106,778,904 T307A probably benign Het
Tshz1 T C 18: 84,015,641 Y214C probably damaging Het
Vmn2r105 T A 17: 20,228,565 T117S probably benign Het
Vmn2r45 A G 7: 8,481,343 Y488H probably benign Het
Vwa8 A T 14: 79,082,814 K1088N probably benign Het
Wdr35 T C 12: 8,986,000 V257A probably benign Het
Zfp189 T A 4: 49,521,569 S3T probably benign Het
Zscan22 G A 7: 12,906,906 C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,517,885 R283* probably null Het
Other mutations in Arntl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Arntl APN 7 113303407 missense probably damaging 0.99
diet UTSW 7 113285031 missense probably damaging 1.00
R0308:Arntl UTSW 7 113291536 missense probably damaging 1.00
R2039:Arntl UTSW 7 113285112 missense probably damaging 1.00
R3548:Arntl UTSW 7 113313545 missense probably damaging 1.00
R4355:Arntl UTSW 7 113303406 missense possibly damaging 0.46
R4718:Arntl UTSW 7 113303361 missense probably damaging 0.98
R4725:Arntl UTSW 7 113304359 missense possibly damaging 0.82
R4776:Arntl UTSW 7 113285037 missense probably damaging 1.00
R4920:Arntl UTSW 7 113285114 missense probably damaging 1.00
R4960:Arntl UTSW 7 113299435 critical splice donor site probably null
R4985:Arntl UTSW 7 113285073 missense probably damaging 1.00
R5640:Arntl UTSW 7 113308681 missense probably damaging 1.00
R5739:Arntl UTSW 7 113285031 missense probably damaging 1.00
R6004:Arntl UTSW 7 113280727 missense probably damaging 0.97
R7201:Arntl UTSW 7 113285142 missense probably damaging 1.00
R7214:Arntl UTSW 7 113299403 missense probably benign 0.44
R7218:Arntl UTSW 7 113287183 missense probably damaging 0.96
R7378:Arntl UTSW 7 113299208 missense probably benign 0.44
R7908:Arntl UTSW 7 113313473 missense probably benign
R7989:Arntl UTSW 7 113313473 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGACGAAGACAATGAGCC -3'
(R):5'- TCTTAGAAAAGCCAGCTGACC -3'

Sequencing Primer
(F):5'- CAGACAACGAGGGCTGC -3'
(R):5'- TAAATCCTCTGCCACAGTGG -3'
Posted On2019-10-17