Incidental Mutation 'R7491:Cacna1a'
ID580767
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R7491 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84559293 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 856 (R856S)
Ref Sequence ENSEMBL: ENSMUSP00000112436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121390
AA Change: R856S

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656
AA Change: R856S

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122053
AA Change: R809S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656
AA Change: R809S

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,614,755 probably null Het
5730522E02Rik A T 11: 25,769,014 V44E unknown Het
Adcy9 A G 16: 4,418,809 L246S possibly damaging Het
Adk C T 14: 21,234,929 H123Y probably damaging Het
Adra1b T A 11: 43,835,967 D41V probably benign Het
Ankib1 T G 5: 3,701,911 K710Q probably damaging Het
Aoc2 T A 11: 101,328,377 V542D probably benign Het
Arhgef28 T C 13: 97,944,686 N1221S probably benign Het
Arntl T C 7: 113,299,424 V353A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
Cacna1c T C 6: 118,613,343 M1559V Het
Cdh10 G C 15: 19,013,359 E682Q probably damaging Het
Celsr1 T C 15: 86,032,518 D418G possibly damaging Het
Cfap44 T C 16: 44,470,748 L1537P probably damaging Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Col2a1 C T 15: 97,976,159 V1449I not run Het
Cpt2 A G 4: 107,907,142 F475S probably damaging Het
Cpxm1 T C 2: 130,393,567 T502A probably benign Het
Creb3l2 G T 6: 37,379,859 T91N probably benign Het
D630045J12Rik A T 6: 38,142,666 S1714T possibly damaging Het
Dennd1c C A 17: 57,072,379 V246F probably damaging Het
Dse A G 10: 34,152,565 V843A probably benign Het
Ern2 C A 7: 122,170,533 W810L probably damaging Het
Fer1l6 G A 15: 58,600,432 D906N probably damaging Het
Fry A G 5: 150,466,326 E140G Het
Galnt7 A G 8: 57,552,518 V227A probably damaging Het
Gas2l3 A G 10: 89,413,901 S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm826 A T 2: 160,312,022 S34T unknown Het
Gzmk A T 13: 113,172,001 I222N probably benign Het
Hivep3 A T 4: 120,098,830 T1448S probably benign Het
Hk1 T C 10: 62,295,745 D278G probably damaging Het
Ipo7 C A 7: 110,039,194 Q223K possibly damaging Het
Itga9 T A 9: 118,769,111 I571N probably damaging Het
Itgb6 T C 2: 60,620,376 Y573C probably damaging Het
Kmt2c T A 5: 25,284,564 H4459L probably damaging Het
Limch1 T G 5: 67,054,237 S894R probably damaging Het
Lrit2 A T 14: 37,068,910 Q182L possibly damaging Het
Mlph A T 1: 90,939,378 H374L possibly damaging Het
Mmrn2 A G 14: 34,399,417 H748R probably damaging Het
Mrpl58 T C 11: 115,410,266 V134A possibly damaging Het
Nae1 A T 8: 104,518,239 D353E probably benign Het
Naip5 A C 13: 100,217,071 F1227V probably benign Het
Nln A T 13: 104,069,323 F108I probably damaging Het
Nop16 C T 13: 54,588,604 V94I probably benign Het
Nt5c1b A T 12: 10,374,903 T150S probably benign Het
Olfr960 T G 9: 39,623,972 I281S possibly damaging Het
Pcdha4 T C 18: 36,954,636 V624A probably damaging Het
Pcdhga8 T C 18: 37,727,430 I513T probably benign Het
Prc1 A T 7: 80,309,491 probably null Het
Prpf4 T A 4: 62,417,876 F280Y probably damaging Het
Ptprd T C 4: 76,133,155 E43G probably benign Het
Pum1 T A 4: 130,719,174 D181E probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Rgs1 T C 1: 144,245,396 Y179C probably damaging Het
Rrm1 T C 7: 102,454,557 C238R probably damaging Het
Rusc2 T A 4: 43,426,528 L1484Q probably damaging Het
Sall3 C T 18: 80,972,705 M669I probably benign Het
Saxo1 A C 4: 86,445,407 F280V probably benign Het
Scn2a T C 2: 65,702,008 S655P probably damaging Het
Senp6 G T 9: 80,123,728 E571* probably null Het
Sin3b C G 8: 72,746,441 T463S probably damaging Het
Sirt7 C A 11: 120,619,011 R349L probably benign Het
Skor1 T C 9: 63,146,448 T80A probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc25a23 T A 17: 57,052,822 R310* probably null Het
Slco6c1 A T 1: 97,127,854 H107Q probably benign Het
Slit2 A G 5: 48,219,994 E455G probably benign Het
Smo G C 6: 29,736,120 G37A probably damaging Het
St6galnac1 T C 11: 116,769,184 K101R probably benign Het
Stat1 C A 1: 52,152,371 N628K probably benign Het
Syn2 A T 6: 115,254,654 Y302F probably benign Het
Tapt1 T G 5: 44,188,636 Q324P probably damaging Het
Tcrg-V3 T A 13: 19,242,846 M1K probably null Het
Tgoln1 C T 6: 72,616,420 A26T unknown Het
Timm13 T A 10: 80,900,544 T43S probably benign Het
Tnfrsf19 G A 14: 61,005,205 P77S possibly damaging Het
Trem3 T G 17: 48,257,941 F157V probably benign Het
Trim33 T A 3: 103,326,148 S420T probably benign Het
Trip11 T C 12: 101,885,435 K790R probably damaging Het
Trnt1 A G 6: 106,778,904 T307A probably benign Het
Tshz1 T C 18: 84,015,641 Y214C probably damaging Het
Vmn2r105 T A 17: 20,228,565 T117S probably benign Het
Vmn2r45 A G 7: 8,481,343 Y488H probably benign Het
Vwa8 A T 14: 79,082,814 K1088N probably benign Het
Wdr35 T C 12: 8,986,000 V257A probably benign Het
Zfp189 T A 4: 49,521,569 S3T probably benign Het
Zscan22 G A 7: 12,906,906 C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,517,885 R283* probably null Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1835:Cacna1a UTSW 8 84581357 splice site probably null
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
R7270:Cacna1a UTSW 8 84571237 missense probably damaging 1.00
R7409:Cacna1a UTSW 8 84533402 missense probably damaging 1.00
R7511:Cacna1a UTSW 8 84567682 missense possibly damaging 0.75
R7745:Cacna1a UTSW 8 84559394 missense probably benign 0.01
R7872:Cacna1a UTSW 8 84583654 missense probably damaging 1.00
R7899:Cacna1a UTSW 8 84594173 missense possibly damaging 0.72
R7955:Cacna1a UTSW 8 84583654 missense probably damaging 1.00
R7982:Cacna1a UTSW 8 84594173 missense possibly damaging 0.72
RF029:Cacna1a UTSW 8 84638724 small insertion probably benign
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGAATCCACTGGAGTTGCGG -3'
(R):5'- ACTCACTTTCTGCGTCGGTG -3'

Sequencing Primer
(F):5'- TCCTTGCCTTGCAGGAAG -3'
(R):5'- CCTGTCGTCGGGTTCGTC -3'
Posted On2019-10-17