Incidental Mutation 'R0633:Msr1'
ID58078
Institutional Source Beutler Lab
Gene Symbol Msr1
Ensembl Gene ENSMUSG00000025044
Gene Namemacrophage scavenger receptor 1
SynonymsSR-AI, MSR-A, SR-AII, Scara1, Scvr, MRS-A
MMRRC Submission 038822-MU
Accession Numbers

Ncbi RefSeq: NM_001113326; MGI:98257

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location39581685-39642673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39620000 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 170 (E170G)
Ref Sequence ENSEMBL: ENSMUSP00000147644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026021] [ENSMUST00000170091] [ENSMUST00000210525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026021
AA Change: E236G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026021
Gene: ENSMUSG00000025044
AA Change: E236G

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 1.5e-28 PFAM
coiled coil region 209 259 N/A INTRINSIC
Pfam:Collagen 275 330 3.2e-11 PFAM
Pfam:Collagen 295 353 4.8e-10 PFAM
SR 357 457 5.68e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170091
AA Change: E236G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132535
Gene: ENSMUSG00000025044
AA Change: E236G

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 6.6e-34 PFAM
Pfam:Collagen 275 330 1.9e-10 PFAM
Pfam:Collagen 292 352 7.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210525
AA Change: E170G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210681
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal uptake and degradation of acetylated low density lipoproteins by macrophages, increased interleukin-12 secretion in response to CpG oligodeoxynucleotide administration, and increased bacterial and viral infection induced morbidity/mortality. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cdc42bpb T C 12: 111,345,555 I108V probably damaging Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Msr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Msr1 APN 8 39611673 missense probably benign 0.42
IGL02047:Msr1 APN 8 39623960 missense probably benign 0.03
IGL02218:Msr1 APN 8 39589316 missense possibly damaging 0.51
IGL02347:Msr1 APN 8 39632737 missense probably damaging 1.00
IGL02546:Msr1 APN 8 39615747 missense probably benign
IGL02707:Msr1 APN 8 39632829 splice site probably benign
IGL03340:Msr1 APN 8 39620007 missense possibly damaging 0.53
R0349:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R0378:Msr1 UTSW 8 39589382 missense possibly damaging 0.92
R1386:Msr1 UTSW 8 39589293 nonsense probably null
R1807:Msr1 UTSW 8 39619907 missense probably benign 0.33
R2039:Msr1 UTSW 8 39589377 missense probably damaging 1.00
R2174:Msr1 UTSW 8 39631340 missense probably damaging 1.00
R2291:Msr1 UTSW 8 39624222 missense probably benign 0.03
R3983:Msr1 UTSW 8 39620018 missense possibly damaging 0.89
R4807:Msr1 UTSW 8 39642627 start gained probably benign
R4921:Msr1 UTSW 8 39624251 missense possibly damaging 0.72
R5055:Msr1 UTSW 8 39623956 missense possibly damaging 0.78
R5567:Msr1 UTSW 8 39611719 missense probably benign
R5570:Msr1 UTSW 8 39611719 missense probably benign
R5871:Msr1 UTSW 8 39611652 missense probably damaging 0.97
R5914:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R6141:Msr1 UTSW 8 39631319 missense probably damaging 1.00
R6429:Msr1 UTSW 8 39615817 missense probably damaging 0.99
R6519:Msr1 UTSW 8 39624221 missense probably benign
R6527:Msr1 UTSW 8 39624233 missense possibly damaging 0.72
R6842:Msr1 UTSW 8 39632825 missense probably benign 0.01
R7006:Msr1 UTSW 8 39589382 missense probably damaging 0.99
R7047:Msr1 UTSW 8 39642616 missense possibly damaging 0.92
R7135:Msr1 UTSW 8 39589424 missense possibly damaging 0.93
R7552:Msr1 UTSW 8 39623962 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TTCTGTGAACTTGTAGTAACAGCACCC -3'
(R):5'- CTGTAACGTTCCCCTAAGGCTATATGC -3'

Sequencing Primer
(F):5'- GGAATGTCAAATACCAAATGCCTG -3'
(R):5'- GGCTATATGCTTTCCAAAAATCACAG -3'
Posted On2013-07-11