Incidental Mutation 'R7491:Cfap44'
ID580802
Institutional Source Beutler Lab
Gene Symbol Cfap44
Ensembl Gene ENSMUSG00000071550
Gene Namecilia and flagella associated protein 44
Synonyms6330444M21Rik, D16Ertd642e, Wdr52
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7491 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location44394796-44482428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44470748 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1537 (L1537P)
Ref Sequence ENSEMBL: ENSMUSP00000097331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]
Predicted Effect probably damaging
Transcript: ENSMUST00000099742
AA Change: L1537P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: L1537P

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120049
AA Change: L1537P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: L1537P

DomainStartEndE-ValueType
low complexity region 42 64 N/A INTRINSIC
low complexity region 76 92 N/A INTRINSIC
Blast:WD40 161 201 1e-7 BLAST
WD40 204 246 4.58e1 SMART
WD40 249 288 4.62e-1 SMART
Blast:WD40 292 337 2e-15 BLAST
WD40 342 381 4.8e-2 SMART
WD40 447 486 4.95e-4 SMART
WD40 491 532 2.64e2 SMART
WD40 552 591 2.98e-7 SMART
Blast:WD40 595 634 1e-19 BLAST
coiled coil region 669 711 N/A INTRINSIC
WD40 780 820 3.82e1 SMART
WD40 830 872 2.4e-2 SMART
coiled coil region 907 955 N/A INTRINSIC
coiled coil region 1101 1122 N/A INTRINSIC
low complexity region 1266 1295 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
coiled coil region 1402 1459 N/A INTRINSIC
low complexity region 1476 1488 N/A INTRINSIC
low complexity region 1489 1523 N/A INTRINSIC
coiled coil region 1543 1607 N/A INTRINSIC
coiled coil region 1630 1731 N/A INTRINSIC
coiled coil region 1795 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G T 2: 68,614,755 probably null Het
5730522E02Rik A T 11: 25,769,014 V44E unknown Het
Adcy9 A G 16: 4,418,809 L246S possibly damaging Het
Adk C T 14: 21,234,929 H123Y probably damaging Het
Adra1b T A 11: 43,835,967 D41V probably benign Het
Ankib1 T G 5: 3,701,911 K710Q probably damaging Het
Aoc2 T A 11: 101,328,377 V542D probably benign Het
Arhgef28 T C 13: 97,944,686 N1221S probably benign Het
Arntl T C 7: 113,299,424 V353A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT 3: 95,888,138 probably benign Het
Cacna1a C A 8: 84,559,293 R856S possibly damaging Het
Cacna1c T C 6: 118,613,343 M1559V Het
Cdh10 G C 15: 19,013,359 E682Q probably damaging Het
Celsr1 T C 15: 86,032,518 D418G possibly damaging Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Col2a1 C T 15: 97,976,159 V1449I not run Het
Cpt2 A G 4: 107,907,142 F475S probably damaging Het
Cpxm1 T C 2: 130,393,567 T502A probably benign Het
Creb3l2 G T 6: 37,379,859 T91N probably benign Het
D630045J12Rik A T 6: 38,142,666 S1714T possibly damaging Het
Dennd1c C A 17: 57,072,379 V246F probably damaging Het
Dse A G 10: 34,152,565 V843A probably benign Het
Ern2 C A 7: 122,170,533 W810L probably damaging Het
Fer1l6 G A 15: 58,600,432 D906N probably damaging Het
Fry A G 5: 150,466,326 E140G Het
Galnt7 A G 8: 57,552,518 V227A probably damaging Het
Gas2l3 A G 10: 89,413,901 S452P probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm826 A T 2: 160,312,022 S34T unknown Het
Gzmk A T 13: 113,172,001 I222N probably benign Het
Hivep3 A T 4: 120,098,830 T1448S probably benign Het
Hk1 T C 10: 62,295,745 D278G probably damaging Het
Ipo7 C A 7: 110,039,194 Q223K possibly damaging Het
Itga9 T A 9: 118,769,111 I571N probably damaging Het
Itgb6 T C 2: 60,620,376 Y573C probably damaging Het
Kmt2c T A 5: 25,284,564 H4459L probably damaging Het
Limch1 T G 5: 67,054,237 S894R probably damaging Het
Lrit2 A T 14: 37,068,910 Q182L possibly damaging Het
Mlph A T 1: 90,939,378 H374L possibly damaging Het
Mmrn2 A G 14: 34,399,417 H748R probably damaging Het
Mrpl58 T C 11: 115,410,266 V134A possibly damaging Het
Nae1 A T 8: 104,518,239 D353E probably benign Het
Naip5 A C 13: 100,217,071 F1227V probably benign Het
Nln A T 13: 104,069,323 F108I probably damaging Het
Nop16 C T 13: 54,588,604 V94I probably benign Het
Nt5c1b A T 12: 10,374,903 T150S probably benign Het
Olfr960 T G 9: 39,623,972 I281S possibly damaging Het
Pcdha4 T C 18: 36,954,636 V624A probably damaging Het
Pcdhga8 T C 18: 37,727,430 I513T probably benign Het
Prc1 A T 7: 80,309,491 probably null Het
Prpf4 T A 4: 62,417,876 F280Y probably damaging Het
Ptprd T C 4: 76,133,155 E43G probably benign Het
Pum1 T A 4: 130,719,174 D181E probably benign Het
Rab7 A G 6: 88,013,642 S17P probably damaging Het
Rgs1 T C 1: 144,245,396 Y179C probably damaging Het
Rrm1 T C 7: 102,454,557 C238R probably damaging Het
Rusc2 T A 4: 43,426,528 L1484Q probably damaging Het
Sall3 C T 18: 80,972,705 M669I probably benign Het
Saxo1 A C 4: 86,445,407 F280V probably benign Het
Scn2a T C 2: 65,702,008 S655P probably damaging Het
Senp6 G T 9: 80,123,728 E571* probably null Het
Sin3b C G 8: 72,746,441 T463S probably damaging Het
Sirt7 C A 11: 120,619,011 R349L probably benign Het
Skor1 T C 9: 63,146,448 T80A probably damaging Het
Slc12a9 C A 5: 137,322,820 A478S probably damaging Het
Slc25a23 T A 17: 57,052,822 R310* probably null Het
Slco6c1 A T 1: 97,127,854 H107Q probably benign Het
Slit2 A G 5: 48,219,994 E455G probably benign Het
Smo G C 6: 29,736,120 G37A probably damaging Het
St6galnac1 T C 11: 116,769,184 K101R probably benign Het
Stat1 C A 1: 52,152,371 N628K probably benign Het
Syn2 A T 6: 115,254,654 Y302F probably benign Het
Tapt1 T G 5: 44,188,636 Q324P probably damaging Het
Tcrg-V3 T A 13: 19,242,846 M1K probably null Het
Tgoln1 C T 6: 72,616,420 A26T unknown Het
Timm13 T A 10: 80,900,544 T43S probably benign Het
Tnfrsf19 G A 14: 61,005,205 P77S possibly damaging Het
Trem3 T G 17: 48,257,941 F157V probably benign Het
Trim33 T A 3: 103,326,148 S420T probably benign Het
Trip11 T C 12: 101,885,435 K790R probably damaging Het
Trnt1 A G 6: 106,778,904 T307A probably benign Het
Tshz1 T C 18: 84,015,641 Y214C probably damaging Het
Vmn2r105 T A 17: 20,228,565 T117S probably benign Het
Vmn2r45 A G 7: 8,481,343 Y488H probably benign Het
Vwa8 A T 14: 79,082,814 K1088N probably benign Het
Wdr35 T C 12: 8,986,000 V257A probably benign Het
Zfp189 T A 4: 49,521,569 S3T probably benign Het
Zscan22 G A 7: 12,906,906 C359Y probably damaging Het
Zscan4-ps2 A T 7: 11,517,885 R283* probably null Het
Other mutations in Cfap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Cfap44 APN 16 44407404 missense probably damaging 0.99
IGL00952:Cfap44 APN 16 44421275 missense probably benign 0.33
IGL01340:Cfap44 APN 16 44404130 missense probably damaging 1.00
IGL01530:Cfap44 APN 16 44449167 missense probably damaging 1.00
IGL02083:Cfap44 APN 16 44437162 missense probably damaging 1.00
IGL02088:Cfap44 APN 16 44451628 missense possibly damaging 0.59
IGL02142:Cfap44 APN 16 44421144 missense probably benign 0.15
IGL02311:Cfap44 APN 16 44404771 splice site probably benign
IGL02574:Cfap44 APN 16 44481383 missense probably damaging 1.00
IGL02893:Cfap44 APN 16 44416817 missense probably damaging 1.00
IGL02959:Cfap44 APN 16 44470867 splice site probably benign
IGL03291:Cfap44 APN 16 44407311 missense possibly damaging 0.86
feldgrau UTSW 16 44433666 nonsense probably null
I2288:Cfap44 UTSW 16 44449138 nonsense probably null
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0023:Cfap44 UTSW 16 44421220 missense probably benign 0.01
R0036:Cfap44 UTSW 16 44439069 missense possibly damaging 0.83
R0139:Cfap44 UTSW 16 44433422 missense possibly damaging 0.90
R0145:Cfap44 UTSW 16 44468372 missense probably damaging 1.00
R0193:Cfap44 UTSW 16 44449210 splice site probably null
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0238:Cfap44 UTSW 16 44422318 missense probably benign
R0288:Cfap44 UTSW 16 44415894 splice site probably benign
R0367:Cfap44 UTSW 16 44433476 critical splice donor site probably null
R0452:Cfap44 UTSW 16 44431945 missense probably benign 0.01
R0531:Cfap44 UTSW 16 44401426 start codon destroyed probably benign 0.01
R0722:Cfap44 UTSW 16 44404676 missense possibly damaging 0.94
R0801:Cfap44 UTSW 16 44422486 missense probably benign 0.41
R1209:Cfap44 UTSW 16 44422417 missense possibly damaging 0.86
R1215:Cfap44 UTSW 16 44419303 missense probably damaging 1.00
R1385:Cfap44 UTSW 16 44470775 missense probably damaging 1.00
R1400:Cfap44 UTSW 16 44421212 missense probably benign 0.01
R1415:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R1475:Cfap44 UTSW 16 44433812 splice site probably benign
R1901:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1902:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R1903:Cfap44 UTSW 16 44422374 missense probably benign 0.00
R2023:Cfap44 UTSW 16 44416012 missense probably benign 0.01
R2126:Cfap44 UTSW 16 44410475 missense probably benign 0.40
R2147:Cfap44 UTSW 16 44451684 missense probably benign 0.31
R2233:Cfap44 UTSW 16 44451525 missense probably benign 0.01
R2439:Cfap44 UTSW 16 44481246 unclassified probably benign
R3015:Cfap44 UTSW 16 44410469 missense probably benign 0.40
R4178:Cfap44 UTSW 16 44451853 missense possibly damaging 0.81
R4421:Cfap44 UTSW 16 44422437 missense probably damaging 1.00
R4516:Cfap44 UTSW 16 44473864 nonsense probably null
R4742:Cfap44 UTSW 16 44449252 intron probably null
R4766:Cfap44 UTSW 16 44415883 splice site probably null
R4810:Cfap44 UTSW 16 44451535 missense probably damaging 0.99
R4955:Cfap44 UTSW 16 44475277 missense possibly damaging 0.75
R5058:Cfap44 UTSW 16 44420204 splice site probably null
R5164:Cfap44 UTSW 16 44481389 missense probably damaging 0.99
R5172:Cfap44 UTSW 16 44449193 missense probably benign
R5344:Cfap44 UTSW 16 44416400 critical splice donor site probably null
R5519:Cfap44 UTSW 16 44404088 missense probably damaging 1.00
R5572:Cfap44 UTSW 16 44481305 missense possibly damaging 0.95
R5601:Cfap44 UTSW 16 44460186 missense probably damaging 1.00
R5625:Cfap44 UTSW 16 44460347 unclassified probably null
R5638:Cfap44 UTSW 16 44455531 missense possibly damaging 0.94
R5727:Cfap44 UTSW 16 44435442 missense probably damaging 0.98
R5950:Cfap44 UTSW 16 44479847 missense probably damaging 0.99
R6057:Cfap44 UTSW 16 44449097 missense probably benign 0.03
R6063:Cfap44 UTSW 16 44429892 missense probably benign 0.00
R6221:Cfap44 UTSW 16 44437186 missense probably benign 0.13
R6277:Cfap44 UTSW 16 44437306 missense probably benign 0.04
R6322:Cfap44 UTSW 16 44433666 nonsense probably null
R6836:Cfap44 UTSW 16 44404079 missense probably damaging 0.99
R6854:Cfap44 UTSW 16 44449028 critical splice acceptor site probably null
R6889:Cfap44 UTSW 16 44404132 missense probably benign 0.03
R7233:Cfap44 UTSW 16 44422408 missense probably damaging 0.99
R7294:Cfap44 UTSW 16 44404893 intron probably benign
R7298:Cfap44 UTSW 16 44481412 missense probably benign 0.04
R7332:Cfap44 UTSW 16 44429828 missense probably damaging 1.00
R7410:Cfap44 UTSW 16 44468413 missense probably damaging 1.00
R7456:Cfap44 UTSW 16 44431942 missense probably benign 0.07
R7587:Cfap44 UTSW 16 44404106 missense probably benign 0.02
R7698:Cfap44 UTSW 16 44433786 missense probably damaging 0.99
R7717:Cfap44 UTSW 16 44429935 missense probably damaging 0.97
V1662:Cfap44 UTSW 16 44449138 nonsense probably null
X0060:Cfap44 UTSW 16 44449074 missense possibly damaging 0.83
Z1088:Cfap44 UTSW 16 44401466 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACTCTGAGGTCTGTCTCTGAC -3'
(R):5'- AACTTCTAGCAATGTCACACCTATG -3'

Sequencing Primer
(F):5'- GTCTCTGACCTCCACATGCAAAC -3'
(R):5'- CTAGCAATGTCACACCTATGAAATAG -3'
Posted On2019-10-17