Mutagenetix > Incidental Mutation

Incidental Mutation 'R7492:Hs2st1'

580824

Institutional Source

Beutler Lab

Gene Symbol

Hs2st1

Ensembl Gene

ENSMUSG00000040151

Gene Name

heparan sulfate 2-O-sulfotransferase 1

Synonyms

Hs2st

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.809) question?

Stock #

R7492 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

144429706-144570181 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 144435596 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 237 (M237K)

Ref Sequence

ENSEMBL: ENSMUSP00000043066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043325]

AlphaFold

Q8R3H7

Predicted Effect

probably benign
Transcript: ENSMUST00000043325
AA Change: M237K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000043066
Gene: ENSMUSG00000040151
AA Change: M237K

Domain	Start	End	E-Value	Type
coiled coil region	21	58	N/A	INTRINSIC
Pfam:Sulfotransfer_2	66	327	9.1e-44	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: A mutation in this gene causes bilateral renal agenesis, bone defects, eye development abnormalities and cataracts in homozygous mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	A	G	15: 82,064,359	D819G	possibly damaging	Het
A830010M20Rik	G	A	5: 107,510,507	E1648K	probably benign	Het
Abca13	A	T	11: 9,293,167	I1677L	probably benign	Het
Ablim2	A	G	5: 35,841,329	S367G	probably benign	Het
Afdn	G	C	17: 13,848,376		probably null	Het
Aldh6a1	A	G	12: 84,436,866	L302P	probably damaging	Het
Ank3	A	G	10: 69,882,527	D536G	unknown	Het
Ankrd17	A	G	5: 90,233,948	V2454A	possibly damaging	Het
Apol7e	G	A	15: 77,717,456	E85K	possibly damaging	Het
Atmin	A	G	8: 116,956,918	D439G	probably damaging	Het
AU040320	G	T	4: 126,847,855	C952F	possibly damaging	Het
BC055324	A	G	1: 163,959,328	I724T	probably benign	Het
C6	A	G	15: 4,731,714	S19G	probably benign	Het
Ccdc180	A	T	4: 45,930,009		probably null	Het
Cntn1	A	C	15: 92,314,542	T862P	probably benign	Het
Col5a1	T	C	2: 27,969,800		probably null	Het
D430041D05Rik	T	C	2: 104,201,305	K964E	probably damaging	Het
Dnajc18	T	C	18: 35,686,793	Y145C	probably damaging	Het
Dsc1	C	T	18: 20,107,680	C196Y	possibly damaging	Het
Efcab11	A	C	12: 99,878,401	I58R	possibly damaging	Het
Fam81b	T	A	13: 76,271,279	I51F	probably benign	Het
Fbln1	G	A	15: 85,227,061	V139M	probably damaging	Het
Fbxw25	A	G	9: 109,664,530		probably null	Het
Fech	C	T	18: 64,467,771	W220*	probably null	Het
Fgl1	C	T	8: 41,191,587	W293*	probably null	Het
Foxi2	T	C	7: 135,410,572	L63P	probably damaging	Het
Frmpd1	A	G	4: 45,285,237	R1353G	possibly damaging	Het
Fthl17b	C	T	X: 8,962,804	R9Q	possibly damaging	Het
Fthl17b	C	T	X: 8,962,808	V8M	possibly damaging	Het
Galnt5	T	A	2: 58,026,036		probably null	Het
Glb1	A	T	9: 114,473,949	I618F	probably damaging	Het
Gm13083	C	A	4: 143,616,174	Q284K	not run	Het
Ighm	T	C	12: 113,422,673	D19G		Het
Il1f10	A	G	2: 24,292,817	D35G	probably benign	Het
Itpr2	G	A	6: 146,390,938	T419I	probably damaging	Het
Khdc1a	A	T	1: 21,350,318	E54V	possibly damaging	Het
Kif19a	A	G	11: 114,790,239	D991G	probably benign	Het
Klhl18	A	C	9: 110,428,775	Y532*	probably null	Het
Lama1	T	C	17: 67,817,651	F2902S		Het
Lrba	T	C	3: 86,664,528	S2380P	probably damaging	Het
Lrp2	T	A	2: 69,537,581	I196F	probably damaging	Het
Macf1	T	C	4: 123,475,731	K1746E	possibly damaging	Het
Megf10	T	C	18: 57,291,794	Y1002H	probably benign	Het
Megf8	A	G	7: 25,353,848	T1815A	probably benign	Het
Mtg1	T	C	7: 140,144,697	L162P	probably damaging	Het
Myo6	T	A	9: 80,288,046	Y899*	probably null	Het
Nlrp9a	A	T	7: 26,557,656	D233V	probably damaging	Het
Olfr1083-ps	T	A	2: 86,606,719	N284I	unknown	Het
Olfr122	A	T	17: 37,771,680	Q9L	possibly damaging	Het
Olfr1295	C	A	2: 111,564,821	V208L	probably benign	Het
Olfr30	T	A	11: 58,455,889	N20I	probably benign	Het
Olfr770	T	A	10: 129,133,640	I43F	probably damaging	Het
Parvb	A	T	15: 84,290,450	Q148L	probably damaging	Het
Pcdhb11	C	T	18: 37,423,444	T609M	probably damaging	Het
Pcdhga3	A	T	18: 37,676,125	T544S	probably benign	Het
Pkd1	C	G	17: 24,569,741	I824M	probably benign	Het
Pkd1l2	A	T	8: 117,068,110	L370Q	probably damaging	Het
Plcb1	G	T	2: 135,251,764	E166*	probably null	Het
Pnpt1	A	G	11: 29,135,522	I138V	probably benign	Het
Pou4f3	T	C	18: 42,395,931	L313P	probably damaging	Het
Prep	A	G	10: 45,120,814	Y396C	probably damaging	Het
Prkd3	A	T	17: 78,962,545	C562*	probably null	Het
Prss12	T	A	3: 123,482,776	C351*	probably null	Het
Rnf41	C	A	10: 128,438,414	H312N	probably damaging	Het
Ror1	C	T	4: 100,441,059	T543I	probably benign	Het
Rreb1	G	A	13: 37,931,748	V1028I	probably benign	Het
Setd2	T	A	9: 110,594,632	S474T		Het
Slc1a2	T	A	2: 102,739,930	C184*	probably null	Het
Slc2a4	G	A	11: 69,946,376	T78I	probably benign	Het
Slc4a4	T	A	5: 89,129,650	I317N	possibly damaging	Het
Smad9	G	A	3: 54,786,326		probably null	Het
Sst	T	C	16: 23,889,826	E85G	probably damaging	Het
Svep1	T	G	4: 58,066,468	E3205D	possibly damaging	Het
Tmc7	G	T	7: 118,541,966	S647R	probably benign	Het
Tmem173	T	C	18: 35,738,713	Y162C	probably damaging	Het
Trnt1	T	C	6: 106,774,532	S157P	possibly damaging	Het
Ttc6	A	T	12: 57,673,136	H831L	probably benign	Het
Vmn1r121	A	G	7: 21,098,170	F115S	probably damaging	Het
Vwa7	A	G	17: 35,019,044	D207G	possibly damaging	Het
Vwde	C	A	6: 13,204,981	K300N	probably null	Het
Zfp418	A	G	7: 7,181,397	T120A	possibly damaging	Het
Zfp687	C	T	3: 95,007,530	R1220H	probably damaging	Het

Other mutations in Hs2st1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0037:Hs2st1	UTSW	3	144437644	nonsense	probably null
R1215:Hs2st1	UTSW	3	144465141	missense	possibly damaging	0.75
R1450:Hs2st1	UTSW	3	144434718	splice site	probably benign
R1474:Hs2st1	UTSW	3	144435495	missense	possibly damaging	0.94
R1505:Hs2st1	UTSW	3	144434561	missense	probably benign	0.19
R1695:Hs2st1	UTSW	3	144434654	missense	probably benign	0.00
R2511:Hs2st1	UTSW	3	144569930	unclassified	probably benign
R2967:Hs2st1	UTSW	3	144465138	missense	probably damaging	1.00
R3928:Hs2st1	UTSW	3	144434628	missense	possibly damaging	0.55
R4895:Hs2st1	UTSW	3	144465253	missense	probably benign
R4911:Hs2st1	UTSW	3	144465082	missense	probably benign	0.23
R5477:Hs2st1	UTSW	3	144556948	critical splice donor site	probably benign
R5666:Hs2st1	UTSW	3	144569793	missense	probably damaging	0.97
R6262:Hs2st1	UTSW	3	144434613	missense	probably damaging	0.96
R7230:Hs2st1	UTSW	3	144434546	missense	probably benign
R7372:Hs2st1	UTSW	3	144435460	critical splice donor site	probably null
R7720:Hs2st1	UTSW	3	144454022	missense	probably damaging	1.00
R8309:Hs2st1	UTSW	3	144437604	missense	possibly damaging	0.74
R8497:Hs2st1	UTSW	3	144434691	missense	probably damaging	1.00
X0019:Hs2st1	UTSW	3	144454012	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CTTTATCACAGAGCAAGTCAGTG -3'
(R):5'- TTCCAGAACCCTTCAGGAGC -3'

Sequencing Primer
(F):5'- CAAGTCAGTGAGGGCCGTG -3'
(R):5'- AGAACCCTTCAGGAGCGTCTG -3'

Posted On

2019-10-17