Incidental Mutation 'R7492:Hs2st1'
ID 580824
Institutional Source Beutler Lab
Gene Symbol Hs2st1
Ensembl Gene ENSMUSG00000040151
Gene Name heparan sulfate 2-O-sulfotransferase 1
Synonyms Hs2st
MMRRC Submission 045566-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.688) question?
Stock # R7492 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 144135467-144275942 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144141357 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 237 (M237K)
Ref Sequence ENSEMBL: ENSMUSP00000043066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043325]
AlphaFold Q8R3H7
Predicted Effect probably benign
Transcript: ENSMUST00000043325
AA Change: M237K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000043066
Gene: ENSMUSG00000040151
AA Change: M237K

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
Pfam:Sulfotransfer_2 66 327 9.1e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. This gene encodes a member of the heparan sulfate biosynthetic enzyme family that transfers sulfate to the 2 position of the iduronic acid residue of heparan sulfate. The disruption of this gene resulted in no kidney formation in knockout embryonic mice, indicating that the absence of this enzyme may interfere with the signaling required for kidney formation. Two alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: A mutation in this gene causes bilateral renal agenesis, bone defects, eye development abnormalities and cataracts in homozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 81,948,560 (GRCm39) D819G possibly damaging Het
Abca13 A T 11: 9,243,167 (GRCm39) I1677L probably benign Het
Ablim2 A G 5: 35,998,673 (GRCm39) S367G probably benign Het
Afdn G C 17: 14,068,638 (GRCm39) probably null Het
Aldh6a1 A G 12: 84,483,640 (GRCm39) L302P probably damaging Het
Ank3 A G 10: 69,718,357 (GRCm39) D536G unknown Het
Ankrd17 A G 5: 90,381,807 (GRCm39) V2454A possibly damaging Het
Apol7e G A 15: 77,601,656 (GRCm39) E85K possibly damaging Het
Atmin A G 8: 117,683,657 (GRCm39) D439G probably damaging Het
AU040320 G T 4: 126,741,648 (GRCm39) C952F possibly damaging Het
Btbd8 G A 5: 107,658,373 (GRCm39) E1648K probably benign Het
C6 A G 15: 4,761,196 (GRCm39) S19G probably benign Het
Ccdc180 A T 4: 45,930,009 (GRCm39) probably null Het
Cntn1 A C 15: 92,212,423 (GRCm39) T862P probably benign Het
Col5a1 T C 2: 27,859,812 (GRCm39) probably null Het
D430041D05Rik T C 2: 104,031,650 (GRCm39) K964E probably damaging Het
Dnajc18 T C 18: 35,819,846 (GRCm39) Y145C probably damaging Het
Dsc1 C T 18: 20,240,737 (GRCm39) C196Y possibly damaging Het
Efcab11 A C 12: 99,844,660 (GRCm39) I58R possibly damaging Het
Fam81b T A 13: 76,419,398 (GRCm39) I51F probably benign Het
Fbln1 G A 15: 85,111,262 (GRCm39) V139M probably damaging Het
Fbxw25 A G 9: 109,493,598 (GRCm39) probably null Het
Fech C T 18: 64,600,842 (GRCm39) W220* probably null Het
Fgl1 C T 8: 41,644,624 (GRCm39) W293* probably null Het
Firrm A G 1: 163,786,897 (GRCm39) I724T probably benign Het
Foxi2 T C 7: 135,012,301 (GRCm39) L63P probably damaging Het
Frmpd1 A G 4: 45,285,237 (GRCm39) R1353G possibly damaging Het
Fthl17b C T X: 8,829,043 (GRCm39) R9Q possibly damaging Het
Fthl17b C T X: 8,829,047 (GRCm39) V8M possibly damaging Het
Galnt5 T A 2: 57,916,048 (GRCm39) probably null Het
Glb1 A T 9: 114,303,017 (GRCm39) I618F probably damaging Het
Ighm T C 12: 113,386,293 (GRCm39) D19G Het
Il1f10 A G 2: 24,182,829 (GRCm39) D35G probably benign Het
Itpr2 G A 6: 146,292,436 (GRCm39) T419I probably damaging Het
Khdc1a A T 1: 21,420,542 (GRCm39) E54V possibly damaging Het
Kif19a A G 11: 114,681,065 (GRCm39) D991G probably benign Het
Klhl18 A C 9: 110,257,843 (GRCm39) Y532* probably null Het
Lama1 T C 17: 68,124,646 (GRCm39) F2902S Het
Lrba T C 3: 86,571,835 (GRCm39) S2380P probably damaging Het
Lrp2 T A 2: 69,367,925 (GRCm39) I196F probably damaging Het
Macf1 T C 4: 123,369,524 (GRCm39) K1746E possibly damaging Het
Megf10 T C 18: 57,424,866 (GRCm39) Y1002H probably benign Het
Megf8 A G 7: 25,053,273 (GRCm39) T1815A probably benign Het
Mtg1 T C 7: 139,724,610 (GRCm39) L162P probably damaging Het
Myo6 T A 9: 80,195,328 (GRCm39) Y899* probably null Het
Nlrp9a A T 7: 26,257,081 (GRCm39) D233V probably damaging Het
Or10al6 A T 17: 38,082,571 (GRCm39) Q9L possibly damaging Het
Or2z2 T A 11: 58,346,715 (GRCm39) N20I probably benign Het
Or4k45 C A 2: 111,395,166 (GRCm39) V208L probably benign Het
Or6c201 T A 10: 128,969,509 (GRCm39) I43F probably damaging Het
Or8k36-ps1 T A 2: 86,437,063 (GRCm39) N284I unknown Het
Parvb A T 15: 84,174,651 (GRCm39) Q148L probably damaging Het
Pcdhb11 C T 18: 37,556,497 (GRCm39) T609M probably damaging Het
Pcdhga3 A T 18: 37,809,178 (GRCm39) T544S probably benign Het
Pkd1 C G 17: 24,788,715 (GRCm39) I824M probably benign Het
Pkd1l2 A T 8: 117,794,849 (GRCm39) L370Q probably damaging Het
Plcb1 G T 2: 135,093,684 (GRCm39) E166* probably null Het
Pnpt1 A G 11: 29,085,522 (GRCm39) I138V probably benign Het
Pou4f3 T C 18: 42,528,996 (GRCm39) L313P probably damaging Het
Pramel21 C A 4: 143,342,744 (GRCm39) Q284K not run Het
Prep A G 10: 44,996,910 (GRCm39) Y396C probably damaging Het
Prkd3 A T 17: 79,269,974 (GRCm39) C562* probably null Het
Prss12 T A 3: 123,276,425 (GRCm39) C351* probably null Het
Rnf41 C A 10: 128,274,283 (GRCm39) H312N probably damaging Het
Ror1 C T 4: 100,298,256 (GRCm39) T543I probably benign Het
Rreb1 G A 13: 38,115,724 (GRCm39) V1028I probably benign Het
Setd2 T A 9: 110,423,700 (GRCm39) S474T Het
Slc1a2 T A 2: 102,570,275 (GRCm39) C184* probably null Het
Slc2a4 G A 11: 69,837,202 (GRCm39) T78I probably benign Het
Slc4a4 T A 5: 89,277,509 (GRCm39) I317N possibly damaging Het
Smad9 G A 3: 54,693,747 (GRCm39) probably null Het
Sst T C 16: 23,708,576 (GRCm39) E85G probably damaging Het
Sting1 T C 18: 35,871,766 (GRCm39) Y162C probably damaging Het
Svep1 T G 4: 58,066,468 (GRCm39) E3205D possibly damaging Het
Tmc7 G T 7: 118,141,189 (GRCm39) S647R probably benign Het
Trnt1 T C 6: 106,751,493 (GRCm39) S157P possibly damaging Het
Ttc6 A T 12: 57,719,922 (GRCm39) H831L probably benign Het
Vmn1r121 A G 7: 20,832,095 (GRCm39) F115S probably damaging Het
Vwa7 A G 17: 35,238,020 (GRCm39) D207G possibly damaging Het
Vwde C A 6: 13,204,980 (GRCm39) K300N probably null Het
Zfp418 A G 7: 7,184,396 (GRCm39) T120A possibly damaging Het
Zfp687 C T 3: 94,914,841 (GRCm39) R1220H probably damaging Het
Other mutations in Hs2st1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0037:Hs2st1 UTSW 3 144,143,405 (GRCm39) nonsense probably null
R1215:Hs2st1 UTSW 3 144,170,902 (GRCm39) missense possibly damaging 0.75
R1450:Hs2st1 UTSW 3 144,140,479 (GRCm39) splice site probably benign
R1474:Hs2st1 UTSW 3 144,141,256 (GRCm39) missense possibly damaging 0.94
R1505:Hs2st1 UTSW 3 144,140,322 (GRCm39) missense probably benign 0.19
R1695:Hs2st1 UTSW 3 144,140,415 (GRCm39) missense probably benign 0.00
R2511:Hs2st1 UTSW 3 144,275,691 (GRCm39) unclassified probably benign
R2967:Hs2st1 UTSW 3 144,170,899 (GRCm39) missense probably damaging 1.00
R3928:Hs2st1 UTSW 3 144,140,389 (GRCm39) missense possibly damaging 0.55
R4895:Hs2st1 UTSW 3 144,171,014 (GRCm39) missense probably benign
R4911:Hs2st1 UTSW 3 144,170,843 (GRCm39) missense probably benign 0.23
R5477:Hs2st1 UTSW 3 144,262,709 (GRCm39) critical splice donor site probably benign
R5666:Hs2st1 UTSW 3 144,275,554 (GRCm39) missense probably damaging 0.97
R6262:Hs2st1 UTSW 3 144,140,374 (GRCm39) missense probably damaging 0.96
R7230:Hs2st1 UTSW 3 144,140,307 (GRCm39) missense probably benign
R7372:Hs2st1 UTSW 3 144,141,221 (GRCm39) critical splice donor site probably null
R7720:Hs2st1 UTSW 3 144,159,783 (GRCm39) missense probably damaging 1.00
R8309:Hs2st1 UTSW 3 144,143,365 (GRCm39) missense possibly damaging 0.74
R8497:Hs2st1 UTSW 3 144,140,452 (GRCm39) missense probably damaging 1.00
X0019:Hs2st1 UTSW 3 144,159,773 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTTATCACAGAGCAAGTCAGTG -3'
(R):5'- TTCCAGAACCCTTCAGGAGC -3'

Sequencing Primer
(F):5'- CAAGTCAGTGAGGGCCGTG -3'
(R):5'- AGAACCCTTCAGGAGCGTCTG -3'
Posted On 2019-10-17