Incidental Mutation 'R7492:Megf8'
ID580840
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R7492 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25353848 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1815 (T1815A)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect probably benign
Transcript: ENSMUST00000128119
AA Change: T1815A

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: T1815A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,359 D819G possibly damaging Het
A830010M20Rik G A 5: 107,510,507 E1648K probably benign Het
Abca13 A T 11: 9,293,167 I1677L probably benign Het
Ablim2 A G 5: 35,841,329 S367G probably benign Het
Afdn G C 17: 13,848,376 probably null Het
Aldh6a1 A G 12: 84,436,866 L302P probably damaging Het
Ank3 A G 10: 69,882,527 D536G unknown Het
Ankrd17 A G 5: 90,233,948 V2454A possibly damaging Het
Apol7e G A 15: 77,717,456 E85K possibly damaging Het
Atmin A G 8: 116,956,918 D439G probably damaging Het
AU040320 G T 4: 126,847,855 C952F possibly damaging Het
BC055324 A G 1: 163,959,328 I724T probably benign Het
C6 A G 15: 4,731,714 S19G probably benign Het
Ccdc180 A T 4: 45,930,009 probably null Het
Cntn1 A C 15: 92,314,542 T862P probably benign Het
Col5a1 T C 2: 27,969,800 probably null Het
D430041D05Rik T C 2: 104,201,305 K964E probably damaging Het
Dnajc18 T C 18: 35,686,793 Y145C probably damaging Het
Dsc1 C T 18: 20,107,680 C196Y possibly damaging Het
Efcab11 A C 12: 99,878,401 I58R possibly damaging Het
Fam81b T A 13: 76,271,279 I51F probably benign Het
Fbln1 G A 15: 85,227,061 V139M probably damaging Het
Fbxw25 A G 9: 109,664,530 probably null Het
Fech C T 18: 64,467,771 W220* probably null Het
Fgl1 C T 8: 41,191,587 W293* probably null Het
Foxi2 T C 7: 135,410,572 L63P probably damaging Het
Frmpd1 A G 4: 45,285,237 R1353G possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Galnt5 T A 2: 58,026,036 probably null Het
Glb1 A T 9: 114,473,949 I618F probably damaging Het
Gm13083 C A 4: 143,616,174 Q284K not run Het
Hs2st1 A T 3: 144,435,596 M237K probably benign Het
Ighm T C 12: 113,422,673 D19G Het
Il1f10 A G 2: 24,292,817 D35G probably benign Het
Itpr2 G A 6: 146,390,938 T419I probably damaging Het
Khdc1a A T 1: 21,350,318 E54V possibly damaging Het
Kif19a A G 11: 114,790,239 D991G probably benign Het
Klhl18 A C 9: 110,428,775 Y532* probably null Het
Lama1 T C 17: 67,817,651 F2902S Het
Lrba T C 3: 86,664,528 S2380P probably damaging Het
Lrp2 T A 2: 69,537,581 I196F probably damaging Het
Macf1 T C 4: 123,475,731 K1746E possibly damaging Het
Megf10 T C 18: 57,291,794 Y1002H probably benign Het
Mtg1 T C 7: 140,144,697 L162P probably damaging Het
Myo6 T A 9: 80,288,046 Y899* probably null Het
Nlrp9a A T 7: 26,557,656 D233V probably damaging Het
Olfr1083-ps T A 2: 86,606,719 N284I unknown Het
Olfr122 A T 17: 37,771,680 Q9L possibly damaging Het
Olfr1295 C A 2: 111,564,821 V208L probably benign Het
Olfr30 T A 11: 58,455,889 N20I probably benign Het
Olfr770 T A 10: 129,133,640 I43F probably damaging Het
Parvb A T 15: 84,290,450 Q148L probably damaging Het
Pcdhb11 C T 18: 37,423,444 T609M probably damaging Het
Pcdhga3 A T 18: 37,676,125 T544S probably benign Het
Pkd1 C G 17: 24,569,741 I824M probably benign Het
Pkd1l2 A T 8: 117,068,110 L370Q probably damaging Het
Plcb1 G T 2: 135,251,764 E166* probably null Het
Pnpt1 A G 11: 29,135,522 I138V probably benign Het
Pou4f3 T C 18: 42,395,931 L313P probably damaging Het
Prep A G 10: 45,120,814 Y396C probably damaging Het
Prkd3 A T 17: 78,962,545 C562* probably null Het
Prss12 T A 3: 123,482,776 C351* probably null Het
Rnf41 C A 10: 128,438,414 H312N probably damaging Het
Ror1 C T 4: 100,441,059 T543I probably benign Het
Rreb1 G A 13: 37,931,748 V1028I probably benign Het
Setd2 T A 9: 110,594,632 S474T Het
Slc1a2 T A 2: 102,739,930 C184* probably null Het
Slc2a4 G A 11: 69,946,376 T78I probably benign Het
Slc4a4 T A 5: 89,129,650 I317N possibly damaging Het
Smad9 G A 3: 54,786,326 probably null Het
Sst T C 16: 23,889,826 E85G probably damaging Het
Svep1 T G 4: 58,066,468 E3205D possibly damaging Het
Tmc7 G T 7: 118,541,966 S647R probably benign Het
Tmem173 T C 18: 35,738,713 Y162C probably damaging Het
Trnt1 T C 6: 106,774,532 S157P possibly damaging Het
Ttc6 A T 12: 57,673,136 H831L probably benign Het
Vmn1r121 A G 7: 21,098,170 F115S probably damaging Het
Vwa7 A G 17: 35,019,044 D207G possibly damaging Het
Vwde C A 6: 13,204,981 K300N probably null Het
Zfp418 A G 7: 7,181,397 T120A possibly damaging Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7699:Megf8 UTSW 7 25329928 missense possibly damaging 0.91
R7700:Megf8 UTSW 7 25329928 missense possibly damaging 0.91
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTCCCGACCAGTCTTTCAGG -3'
(R):5'- CCCATGTGTGAGGCAGAAC -3'

Sequencing Primer
(F):5'- ACCAGTCTTTCAGGGGGTCTC -3'
(R):5'- GGCAGAACCTGACAGTCC -3'
Posted On2019-10-17