Incidental Mutation 'R7492:Foxi2'
ID580843
Institutional Source Beutler Lab
Gene Symbol Foxi2
Ensembl Gene ENSMUSG00000048377
Gene Nameforkhead box I2
SynonymsB130055A05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7492 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location135410308-135413622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135410572 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 63 (L63P)
Ref Sequence ENSEMBL: ENSMUSP00000053641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060356]
Predicted Effect probably damaging
Transcript: ENSMUST00000060356
AA Change: L63P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053641
Gene: ENSMUSG00000048377
AA Change: L63P

DomainStartEndE-ValueType
low complexity region 64 82 N/A INTRINSIC
low complexity region 87 108 N/A INTRINSIC
FH 115 205 1.29e-58 SMART
low complexity region 207 213 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
low complexity region 262 278 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,359 D819G possibly damaging Het
A830010M20Rik G A 5: 107,510,507 E1648K probably benign Het
Abca13 A T 11: 9,293,167 I1677L probably benign Het
Ablim2 A G 5: 35,841,329 S367G probably benign Het
Afdn G C 17: 13,848,376 probably null Het
Aldh6a1 A G 12: 84,436,866 L302P probably damaging Het
Ank3 A G 10: 69,882,527 D536G unknown Het
Ankrd17 A G 5: 90,233,948 V2454A possibly damaging Het
Apol7e G A 15: 77,717,456 E85K possibly damaging Het
Atmin A G 8: 116,956,918 D439G probably damaging Het
AU040320 G T 4: 126,847,855 C952F possibly damaging Het
BC055324 A G 1: 163,959,328 I724T probably benign Het
C6 A G 15: 4,731,714 S19G probably benign Het
Ccdc180 A T 4: 45,930,009 probably null Het
Cntn1 A C 15: 92,314,542 T862P probably benign Het
Col5a1 T C 2: 27,969,800 probably null Het
D430041D05Rik T C 2: 104,201,305 K964E probably damaging Het
Dnajc18 T C 18: 35,686,793 Y145C probably damaging Het
Dsc1 C T 18: 20,107,680 C196Y possibly damaging Het
Efcab11 A C 12: 99,878,401 I58R possibly damaging Het
Fam81b T A 13: 76,271,279 I51F probably benign Het
Fbln1 G A 15: 85,227,061 V139M probably damaging Het
Fbxw25 A G 9: 109,664,530 probably null Het
Fech C T 18: 64,467,771 W220* probably null Het
Fgl1 C T 8: 41,191,587 W293* probably null Het
Frmpd1 A G 4: 45,285,237 R1353G possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Galnt5 T A 2: 58,026,036 probably null Het
Glb1 A T 9: 114,473,949 I618F probably damaging Het
Gm13083 C A 4: 143,616,174 Q284K not run Het
Hs2st1 A T 3: 144,435,596 M237K probably benign Het
Ighm T C 12: 113,422,673 D19G Het
Il1f10 A G 2: 24,292,817 D35G probably benign Het
Itpr2 G A 6: 146,390,938 T419I probably damaging Het
Khdc1a A T 1: 21,350,318 E54V possibly damaging Het
Kif19a A G 11: 114,790,239 D991G probably benign Het
Klhl18 A C 9: 110,428,775 Y532* probably null Het
Lama1 T C 17: 67,817,651 F2902S Het
Lrba T C 3: 86,664,528 S2380P probably damaging Het
Lrp2 T A 2: 69,537,581 I196F probably damaging Het
Macf1 T C 4: 123,475,731 K1746E possibly damaging Het
Megf10 T C 18: 57,291,794 Y1002H probably benign Het
Megf8 A G 7: 25,353,848 T1815A probably benign Het
Mtg1 T C 7: 140,144,697 L162P probably damaging Het
Myo6 T A 9: 80,288,046 Y899* probably null Het
Nlrp9a A T 7: 26,557,656 D233V probably damaging Het
Olfr1083-ps T A 2: 86,606,719 N284I unknown Het
Olfr122 A T 17: 37,771,680 Q9L possibly damaging Het
Olfr1295 C A 2: 111,564,821 V208L probably benign Het
Olfr30 T A 11: 58,455,889 N20I probably benign Het
Olfr770 T A 10: 129,133,640 I43F probably damaging Het
Parvb A T 15: 84,290,450 Q148L probably damaging Het
Pcdhb11 C T 18: 37,423,444 T609M probably damaging Het
Pcdhga3 A T 18: 37,676,125 T544S probably benign Het
Pkd1 C G 17: 24,569,741 I824M probably benign Het
Pkd1l2 A T 8: 117,068,110 L370Q probably damaging Het
Plcb1 G T 2: 135,251,764 E166* probably null Het
Pnpt1 A G 11: 29,135,522 I138V probably benign Het
Pou4f3 T C 18: 42,395,931 L313P probably damaging Het
Prep A G 10: 45,120,814 Y396C probably damaging Het
Prkd3 A T 17: 78,962,545 C562* probably null Het
Prss12 T A 3: 123,482,776 C351* probably null Het
Rnf41 C A 10: 128,438,414 H312N probably damaging Het
Ror1 C T 4: 100,441,059 T543I probably benign Het
Rreb1 G A 13: 37,931,748 V1028I probably benign Het
Setd2 T A 9: 110,594,632 S474T Het
Slc1a2 T A 2: 102,739,930 C184* probably null Het
Slc2a4 G A 11: 69,946,376 T78I probably benign Het
Slc4a4 T A 5: 89,129,650 I317N possibly damaging Het
Smad9 G A 3: 54,786,326 probably null Het
Sst T C 16: 23,889,826 E85G probably damaging Het
Svep1 T G 4: 58,066,468 E3205D possibly damaging Het
Tmc7 G T 7: 118,541,966 S647R probably benign Het
Tmem173 T C 18: 35,738,713 Y162C probably damaging Het
Trnt1 T C 6: 106,774,532 S157P possibly damaging Het
Ttc6 A T 12: 57,673,136 H831L probably benign Het
Vmn1r121 A G 7: 21,098,170 F115S probably damaging Het
Vwa7 A G 17: 35,019,044 D207G possibly damaging Het
Vwde C A 6: 13,204,981 K300N probably null Het
Zfp418 A G 7: 7,181,397 T120A possibly damaging Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Foxi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Foxi2 APN 7 135412007 missense probably benign 0.07
IGL02984:Foxi2 UTSW 7 135410398 missense possibly damaging 0.96
R0030:Foxi2 UTSW 7 135411616 missense probably damaging 0.99
R0030:Foxi2 UTSW 7 135411616 missense probably damaging 0.99
R0121:Foxi2 UTSW 7 135411911 missense probably benign
R0830:Foxi2 UTSW 7 135411730 missense probably benign
R2059:Foxi2 UTSW 7 135410677 missense probably damaging 1.00
R3615:Foxi2 UTSW 7 135410451 missense possibly damaging 0.88
R3616:Foxi2 UTSW 7 135410451 missense possibly damaging 0.88
R4021:Foxi2 UTSW 7 135410530 missense probably damaging 1.00
R4764:Foxi2 UTSW 7 135410667 missense probably damaging 1.00
R5048:Foxi2 UTSW 7 135411635 missense probably damaging 1.00
R5257:Foxi2 UTSW 7 135410527 missense probably benign 0.19
R5258:Foxi2 UTSW 7 135410527 missense probably benign 0.19
R5561:Foxi2 UTSW 7 135411647 missense probably damaging 1.00
R5611:Foxi2 UTSW 7 135411704 missense probably benign 0.00
R5667:Foxi2 UTSW 7 135410939 splice site probably null
Z1177:Foxi2 UTSW 7 135410415 missense not run
Z1177:Foxi2 UTSW 7 135411958 missense not run
Predicted Primers PCR Primer
(F):5'- TTTAAAGGGCCCAGGTCAGGAG -3'
(R):5'- ATGGCGATCAGTGCTGAGTAG -3'

Sequencing Primer
(F):5'- TCCCATGAGCTTCAGCACG -3'
(R):5'- TAGGAGTAGGGCGGCCGTAC -3'
Posted On2019-10-17