Incidental Mutation 'R7492:Fbln1'
ID580872
Institutional Source Beutler Lab
Gene Symbol Fbln1
Ensembl Gene ENSMUSG00000006369
Gene Namefibulin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R7492 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location85205949-85286535 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85227061 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 139 (V139M)
Ref Sequence ENSEMBL: ENSMUSP00000054583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057410] [ENSMUST00000109432]
Predicted Effect probably damaging
Transcript: ENSMUST00000057410
AA Change: V139M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054583
Gene: ENSMUSG00000006369
AA Change: V139M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF 530 580 1.25e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109432
AA Change: V139M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105058
Gene: ENSMUSG00000006369
AA Change: V139M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ANATO 36 69 3.67e-9 SMART
ANATO 77 110 1.61e-5 SMART
ANATO 112 144 2.23e-8 SMART
EGF 181 217 2.32e-1 SMART
EGF_CA 218 263 5.08e-7 SMART
EGF_CA 264 309 5.44e-7 SMART
EGF_CA 310 357 9.62e-8 SMART
EGF_CA 358 400 1.11e-12 SMART
EGF_CA 401 442 4.77e-12 SMART
EGF_CA 443 482 1.98e-9 SMART
EGF_CA 483 526 4.7e-11 SMART
EGF_CA 527 571 7.18e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fibulin 1 is a secreted glycoprotein that becomes incorporated into a fibrillar extracellular matrix. Calcium-binding is apparently required to mediate its binding to laminin and nidogen. It mediates platelet adhesion via binding fibrinogen. Four splice variants which differ in the 3' end have been identified. Each variant encodes a different isoform, but no functional distinctions have been identified among the four variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene develop problems with spontaneous bleeding as embryos. Most die within the first two days of life. Those that survive this period develop normally and eventually recover from their early developmental abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik A G 15: 82,064,359 D819G possibly damaging Het
A830010M20Rik G A 5: 107,510,507 E1648K probably benign Het
Abca13 A T 11: 9,293,167 I1677L probably benign Het
Ablim2 A G 5: 35,841,329 S367G probably benign Het
Afdn G C 17: 13,848,376 probably null Het
Aldh6a1 A G 12: 84,436,866 L302P probably damaging Het
Ank3 A G 10: 69,882,527 D536G unknown Het
Ankrd17 A G 5: 90,233,948 V2454A possibly damaging Het
Apol7e G A 15: 77,717,456 E85K possibly damaging Het
Atmin A G 8: 116,956,918 D439G probably damaging Het
AU040320 G T 4: 126,847,855 C952F possibly damaging Het
BC055324 A G 1: 163,959,328 I724T probably benign Het
C6 A G 15: 4,731,714 S19G probably benign Het
Ccdc180 A T 4: 45,930,009 probably null Het
Cntn1 A C 15: 92,314,542 T862P probably benign Het
Col5a1 T C 2: 27,969,800 probably null Het
D430041D05Rik T C 2: 104,201,305 K964E probably damaging Het
Dnajc18 T C 18: 35,686,793 Y145C probably damaging Het
Dsc1 C T 18: 20,107,680 C196Y possibly damaging Het
Efcab11 A C 12: 99,878,401 I58R possibly damaging Het
Fam81b T A 13: 76,271,279 I51F probably benign Het
Fbxw25 A G 9: 109,664,530 probably null Het
Fech C T 18: 64,467,771 W220* probably null Het
Fgl1 C T 8: 41,191,587 W293* probably null Het
Foxi2 T C 7: 135,410,572 L63P probably damaging Het
Frmpd1 A G 4: 45,285,237 R1353G possibly damaging Het
Fthl17b C T X: 8,962,804 R9Q possibly damaging Het
Fthl17b C T X: 8,962,808 V8M possibly damaging Het
Galnt5 T A 2: 58,026,036 probably null Het
Glb1 A T 9: 114,473,949 I618F probably damaging Het
Gm13083 C A 4: 143,616,174 Q284K not run Het
Hs2st1 A T 3: 144,435,596 M237K probably benign Het
Ighm T C 12: 113,422,673 D19G Het
Il1f10 A G 2: 24,292,817 D35G probably benign Het
Itpr2 G A 6: 146,390,938 T419I probably damaging Het
Khdc1a A T 1: 21,350,318 E54V possibly damaging Het
Kif19a A G 11: 114,790,239 D991G probably benign Het
Klhl18 A C 9: 110,428,775 Y532* probably null Het
Lama1 T C 17: 67,817,651 F2902S Het
Lrba T C 3: 86,664,528 S2380P probably damaging Het
Lrp2 T A 2: 69,537,581 I196F probably damaging Het
Macf1 T C 4: 123,475,731 K1746E possibly damaging Het
Megf10 T C 18: 57,291,794 Y1002H probably benign Het
Megf8 A G 7: 25,353,848 T1815A probably benign Het
Mtg1 T C 7: 140,144,697 L162P probably damaging Het
Myo6 T A 9: 80,288,046 Y899* probably null Het
Nlrp9a A T 7: 26,557,656 D233V probably damaging Het
Olfr1083-ps T A 2: 86,606,719 N284I unknown Het
Olfr122 A T 17: 37,771,680 Q9L possibly damaging Het
Olfr1295 C A 2: 111,564,821 V208L probably benign Het
Olfr30 T A 11: 58,455,889 N20I probably benign Het
Olfr770 T A 10: 129,133,640 I43F probably damaging Het
Parvb A T 15: 84,290,450 Q148L probably damaging Het
Pcdhb11 C T 18: 37,423,444 T609M probably damaging Het
Pcdhga3 A T 18: 37,676,125 T544S probably benign Het
Pkd1 C G 17: 24,569,741 I824M probably benign Het
Pkd1l2 A T 8: 117,068,110 L370Q probably damaging Het
Plcb1 G T 2: 135,251,764 E166* probably null Het
Pnpt1 A G 11: 29,135,522 I138V probably benign Het
Pou4f3 T C 18: 42,395,931 L313P probably damaging Het
Prep A G 10: 45,120,814 Y396C probably damaging Het
Prkd3 A T 17: 78,962,545 C562* probably null Het
Prss12 T A 3: 123,482,776 C351* probably null Het
Rnf41 C A 10: 128,438,414 H312N probably damaging Het
Ror1 C T 4: 100,441,059 T543I probably benign Het
Rreb1 G A 13: 37,931,748 V1028I probably benign Het
Setd2 T A 9: 110,594,632 S474T Het
Slc1a2 T A 2: 102,739,930 C184* probably null Het
Slc2a4 G A 11: 69,946,376 T78I probably benign Het
Slc4a4 T A 5: 89,129,650 I317N possibly damaging Het
Smad9 G A 3: 54,786,326 probably null Het
Sst T C 16: 23,889,826 E85G probably damaging Het
Svep1 T G 4: 58,066,468 E3205D possibly damaging Het
Tmc7 G T 7: 118,541,966 S647R probably benign Het
Tmem173 T C 18: 35,738,713 Y162C probably damaging Het
Trnt1 T C 6: 106,774,532 S157P possibly damaging Het
Ttc6 A T 12: 57,673,136 H831L probably benign Het
Vmn1r121 A G 7: 21,098,170 F115S probably damaging Het
Vwa7 A G 17: 35,019,044 D207G possibly damaging Het
Vwde C A 6: 13,204,981 K300N probably null Het
Zfp418 A G 7: 7,181,397 T120A possibly damaging Het
Zfp687 C T 3: 95,007,530 R1220H probably damaging Het
Other mutations in Fbln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Fbln1 APN 15 85227037 missense probably benign 0.00
IGL01017:Fbln1 APN 15 85244189 missense possibly damaging 0.94
IGL02514:Fbln1 APN 15 85244262 nonsense probably null
IGL02693:Fbln1 APN 15 85229574 missense probably benign 0.00
IGL02734:Fbln1 APN 15 85226981 missense probably damaging 1.00
IGL02964:Fbln1 APN 15 85231462 missense probably damaging 1.00
IGL03176:Fbln1 APN 15 85244306 missense possibly damaging 0.69
IGL03274:Fbln1 APN 15 85232678 critical splice donor site probably null
R0090:Fbln1 UTSW 15 85224288 missense possibly damaging 0.94
R0148:Fbln1 UTSW 15 85230826 missense probably damaging 0.97
R0393:Fbln1 UTSW 15 85227076 missense probably damaging 0.99
R0564:Fbln1 UTSW 15 85227107 missense probably benign 0.07
R1276:Fbln1 UTSW 15 85229590 missense probably damaging 1.00
R1592:Fbln1 UTSW 15 85231464 missense probably benign 0.00
R1687:Fbln1 UTSW 15 85227106 missense probably benign 0.02
R2312:Fbln1 UTSW 15 85263348 missense probably benign 0.28
R2363:Fbln1 UTSW 15 85227140 critical splice donor site probably null
R3082:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3083:Fbln1 UTSW 15 85265253 missense probably benign 0.25
R3751:Fbln1 UTSW 15 85227078 nonsense probably null
R3752:Fbln1 UTSW 15 85227078 nonsense probably null
R3753:Fbln1 UTSW 15 85227078 nonsense probably null
R4028:Fbln1 UTSW 15 85227116 missense probably benign 0.05
R4406:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4407:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4408:Fbln1 UTSW 15 85231556 critical splice donor site probably null
R4612:Fbln1 UTSW 15 85238559 missense probably benign 0.00
R4811:Fbln1 UTSW 15 85226966 critical splice acceptor site probably null
R5022:Fbln1 UTSW 15 85237626 missense probably damaging 0.99
R5121:Fbln1 UTSW 15 85237671 missense probably damaging 1.00
R7231:Fbln1 UTSW 15 85206152 missense unknown
R7285:Fbln1 UTSW 15 85237628 missense probably benign 0.01
R7742:Fbln1 UTSW 15 85240716 missense probably damaging 1.00
R8100:Fbln1 UTSW 15 85285156 missense probably damaging 1.00
R8379:Fbln1 UTSW 15 85232572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTTCTGAGAACACCGAC -3'
(R):5'- GTAGAATCCAGAAATGTGACACCC -3'

Sequencing Primer
(F):5'- CTGTTCTGAGAACACCGACAAGAAAG -3'
(R):5'- CCCACAGGAAGGGTAAGTCAC -3'
Posted On2019-10-17