Incidental Mutation 'R7493:Cped1'
ID580910
Institutional Source Beutler Lab
Gene Symbol Cped1
Ensembl Gene ENSMUSG00000062980
Gene Namecadherin-like and PC-esterase domain containing 1
SynonymsA430107O13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7493 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location21985916-22256404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22215513 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 682 (D682V)
Ref Sequence ENSEMBL: ENSMUSP00000111041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115383]
Predicted Effect probably damaging
Transcript: ENSMUST00000115383
AA Change: D682V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111041
Gene: ENSMUSG00000062980
AA Change: D682V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 574 663 1e-9 PFAM
Pfam:PC-Esterase 753 1018 2e-26 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119808
Gene: ENSMUSG00000062980
AA Change: D544V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 110 122 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Pfam:Cadherin-like 570 663 6.2e-12 PFAM
Pfam:PC-Esterase 753 963 1.6e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,531 D122G probably benign Het
3110062M04Rik A T 6: 34,874,658 L114Q probably damaging Het
3425401B19Rik A G 14: 32,663,300 L236P possibly damaging Het
4932415D10Rik A T 10: 82,288,964 Y2737* probably null Het
4932415D10Rik T C 10: 82,316,430 Y34C unknown Het
Abca7 T A 10: 80,002,062 D488E probably damaging Het
Adora2a A G 10: 75,333,589 K296E possibly damaging Het
Atp13a4 T A 16: 29,471,956 E225V Het
Bpifb2 A G 2: 153,889,477 M258V possibly damaging Het
Brd2 G A 17: 34,122,257 probably benign Het
Btaf1 G T 19: 37,009,605 V1700F probably damaging Het
C2cd3 A G 7: 100,427,226 I797V Het
Ccdc148 T G 2: 59,009,148 E71A probably damaging Het
Ccdc18 T A 5: 108,206,617 L1074* probably null Het
Ccne2 A G 4: 11,198,772 D215G probably damaging Het
Cers6 T A 2: 68,861,807 probably null Het
Copz1 A G 15: 103,296,544 E110G probably damaging Het
Crb1 A T 1: 139,237,030 C1180S probably damaging Het
Echdc3 A T 2: 6,189,557 L229Q probably damaging Het
Etfb C T 7: 43,454,576 P145L probably damaging Het
Exoc3l2 G T 7: 19,469,888 R135L Het
Fam83a G A 15: 57,986,173 A38T probably damaging Het
G6pc2 T C 2: 69,223,000 Y133H probably benign Het
Gfy T C 7: 45,178,094 I193V probably benign Het
Ggnbp2 T C 11: 84,854,073 T208A probably benign Het
Gigyf1 T A 5: 137,525,533 M1019K probably damaging Het
Gm15922 T C 7: 3,739,024 E119G not run Het
Gm45783 T C 7: 7,370,600 D61G probably damaging Het
Golga5 T C 12: 102,484,576 probably null Het
Ighe A G 12: 113,271,403 V379A Het
Itpr3 C A 17: 27,094,800 H573Q probably benign Het
Klhl2 A G 8: 64,749,775 L463P probably damaging Het
Large1 T G 8: 72,823,715 M619L probably benign Het
Limd1 T A 9: 123,479,683 V149E probably benign Het
Lyz2 T C 10: 117,282,239 K2E probably damaging Het
Man2c1 T A 9: 57,141,128 S858T probably damaging Het
Nt5dc1 A T 10: 34,304,936 N439K probably benign Het
Olfr1173 T C 2: 88,275,101 probably benign Het
Olfr1178 T C 2: 88,391,880 V211A possibly damaging Het
Olfr1239 A G 2: 89,417,801 I204T probably benign Het
Olfr566 A T 7: 102,857,071 Y70* probably null Het
Olfr733 G A 14: 50,298,824 L162F probably benign Het
Olfr845 A C 9: 19,338,813 M118L probably damaging Het
Otogl T C 10: 107,886,982 N296S probably benign Het
Patj A G 4: 98,495,061 N789D probably benign Het
Pcsk6 A G 7: 66,043,566 D851G possibly damaging Het
Peg3 T C 7: 6,709,724 H833R probably damaging Het
Plekha5 A G 6: 140,580,435 D933G probably benign Het
Pnma1 G A 12: 84,147,129 R267C probably damaging Het
Ppp3cb T A 14: 20,508,551 H481L probably benign Het
Prl8a8 T C 13: 27,511,435 probably null Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptpro C A 6: 137,382,649 L406I probably benign Het
Rbpj T C 5: 53,600,934 S18P probably benign Het
Rhbg C T 3: 88,247,579 V173M probably damaging Het
Rps6kc1 A G 1: 190,800,057 S583P probably benign Het
Ryr1 T C 7: 29,095,205 S1217G probably benign Het
S1pr1 A T 3: 115,712,273 I224N probably damaging Het
Sall1 C T 8: 89,031,053 D808N probably benign Het
Shoc2 T C 19: 53,988,036 V119A probably benign Het
Ssh2 A T 11: 77,437,716 E369D probably benign Het
Stx1b C T 7: 127,807,359 V273M possibly damaging Het
Syne2 A G 12: 75,965,880 H2615R probably benign Het
Tmc8 T C 11: 117,784,932 I225T probably benign Het
Tmem126b A G 7: 90,472,646 I52T probably benign Het
Top2b G A 14: 16,416,605 D1122N probably benign Het
Trav13-2 T A 14: 53,634,906 S7T possibly damaging Het
Ttc1 A T 11: 43,745,362 L18Q probably damaging Het
Ttn A T 2: 76,737,209 I27780N probably damaging Het
Ubfd1 T C 7: 122,067,412 S44P probably benign Het
Vmn1r89 A G 7: 13,219,705 K123E probably damaging Het
Vmn2r62 A C 7: 42,787,892 F389L possibly damaging Het
Zdhhc11 T A 13: 73,973,607 M79K possibly damaging Het
Zfp202 G T 9: 40,207,344 V18F possibly damaging Het
Zfp39 A G 11: 58,891,043 F298L possibly damaging Het
Znrf1 G A 8: 111,537,439 G100D probably damaging Het
Other mutations in Cped1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cped1 APN 6 22215523 missense probably damaging 1.00
IGL00909:Cped1 APN 6 22122427 splice site probably benign
IGL01434:Cped1 APN 6 22017005 missense probably damaging 0.99
IGL01572:Cped1 APN 6 22051301 missense probably benign 0.00
IGL02063:Cped1 APN 6 22138702 missense probably damaging 0.98
IGL02216:Cped1 APN 6 22059945 missense probably damaging 1.00
IGL02257:Cped1 APN 6 22145607 missense possibly damaging 0.86
IGL02541:Cped1 APN 6 22120989 missense probably benign 0.00
IGL03008:Cped1 APN 6 22233602 missense probably benign 0.01
IGL03237:Cped1 APN 6 22233596 missense probably damaging 1.00
PIT4382001:Cped1 UTSW 6 22222450 nonsense probably null
PIT4812001:Cped1 UTSW 6 22122294 missense probably benign 0.02
R0048:Cped1 UTSW 6 22119602 missense probably benign 0.08
R0128:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0130:Cped1 UTSW 6 22121039 missense probably benign 0.00
R0267:Cped1 UTSW 6 22119476 missense probably damaging 0.99
R0374:Cped1 UTSW 6 22222546 splice site probably benign
R0482:Cped1 UTSW 6 22016958 missense probably benign 0.32
R0734:Cped1 UTSW 6 22085041 missense probably damaging 1.00
R1033:Cped1 UTSW 6 22016951 missense probably damaging 0.99
R1118:Cped1 UTSW 6 22237699 missense probably benign 0.19
R1181:Cped1 UTSW 6 22215562 missense probably damaging 0.99
R1300:Cped1 UTSW 6 22119553 missense probably benign 0.00
R1485:Cped1 UTSW 6 22132388 critical splice donor site probably null
R1507:Cped1 UTSW 6 22122261 missense probably damaging 1.00
R1830:Cped1 UTSW 6 22237728 missense probably damaging 1.00
R1879:Cped1 UTSW 6 22085015 splice site probably null
R1902:Cped1 UTSW 6 22120981 splice site probably null
R1991:Cped1 UTSW 6 22233927 missense probably damaging 1.00
R2020:Cped1 UTSW 6 22143964 missense probably benign 0.38
R2883:Cped1 UTSW 6 22143979 missense probably damaging 1.00
R3011:Cped1 UTSW 6 22088696 missense probably damaging 1.00
R4466:Cped1 UTSW 6 22123652 missense probably benign 0.29
R4668:Cped1 UTSW 6 22237653 missense probably benign 0.06
R4808:Cped1 UTSW 6 22088757 missense probably damaging 1.00
R5402:Cped1 UTSW 6 22143952 missense probably benign 0.05
R5417:Cped1 UTSW 6 22233580 missense probably null 0.01
R5741:Cped1 UTSW 6 22123621 missense probably benign 0.02
R5821:Cped1 UTSW 6 22138682 missense probably benign 0.00
R5977:Cped1 UTSW 6 22254608 missense probably damaging 1.00
R6255:Cped1 UTSW 6 22138715 splice site probably null
R6304:Cped1 UTSW 6 22016923 missense probably benign 0.14
R6416:Cped1 UTSW 6 22123649 missense probably damaging 1.00
R6444:Cped1 UTSW 6 21986931 missense probably benign 0.00
R6617:Cped1 UTSW 6 22215547 nonsense probably null
R6650:Cped1 UTSW 6 22233976 missense probably damaging 1.00
R7048:Cped1 UTSW 6 22119470 missense probably benign 0.36
R7083:Cped1 UTSW 6 22123580 missense probably benign 0.01
R7234:Cped1 UTSW 6 22254626 missense probably damaging 0.99
R7387:Cped1 UTSW 6 22059934 missense probably benign 0.01
R7720:Cped1 UTSW 6 22222431 missense probably damaging 1.00
R7747:Cped1 UTSW 6 22143974 missense probably damaging 1.00
X0022:Cped1 UTSW 6 21987046 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTCTATGAGATGCCAACCTCAG -3'
(R):5'- AACATGTGCCTATAGACCAAGGG -3'

Sequencing Primer
(F):5'- TCATTGAACAACCTCAGGAGC -3'
(R):5'- CCAAGGGGTCTATTTTAGAGAAAGG -3'
Posted On2019-10-17