Mutagenetix > Incidental Mutations

Incidental Mutation 'R7493:Large1'

580930

Institutional Source

Beutler Lab

Gene Symbol

Large1

Ensembl Gene

ENSMUSG00000004383

Gene Name

LARGE xylosyl- and glucuronyltransferase 1

Synonyms

froggy, BPFD#36, fg, enr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.453) question?

Stock #

R7493 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72814599-73353540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 72823715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 619 (M619L)

Ref Sequence

ENSEMBL: ENSMUSP00000004497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004497] [ENSMUST00000119826] [ENSMUST00000212459]

AlphaFold

Q9Z1M7

Predicted Effect

probably benign
Transcript: ENSMUST00000004497
AA Change: M619L

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000004497
Gene: ENSMUSG00000004383
AA Change: M619L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	141	387	6.2e-22	PFAM
Pfam:Glyco_transf_49	473	540	5.2e-15	PFAM
Pfam:Glyco_transf_49	535	743	1.1e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119826
AA Change: M619L

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000112617
Gene: ENSMUSG00000004383
AA Change: M619L

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
coiled coil region	55	90	N/A	INTRINSIC
Pfam:Glyco_transf_8	142	386	3e-23	PFAM
Pfam:Glyco_transf_49	473	540	2.3e-11	PFAM
Pfam:Glyco_transf_49	520	743	2.7e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212459
AA Change: M619L

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is one of the largest in the human genome, encodes a member of the N-acetylglucosaminyltransferase gene family. It encodes a glycosyltransferase which participates in glycosylation of alpha-dystroglycan, and may carry out the synthesis of glycoprotein and glycosphingolipid sugar chains. It may also be involved in the addition of a repeated disaccharide unit. Mutations in this gene cause MDC1D, a novel form of congenital muscular dystrophy with severe mental retardation and abnormal glycosylation of alpha-dystroglycan. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes exhibit a progressive myopathy, abnormal posture, thoracic kyphosis, calcium deposits in muscle, loss of Schwann cells and myelin, eye and CNS defects, deafness, reduced growth, and death around 4 months. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,015,531	D122G	probably benign	Het
3110062M04Rik	A	T	6: 34,874,658	L114Q	probably damaging	Het
3425401B19Rik	A	G	14: 32,663,300	L236P	possibly damaging	Het
4932415D10Rik	A	T	10: 82,288,964	Y2737*	probably null	Het
4932415D10Rik	T	C	10: 82,316,430	Y34C	unknown	Het
9030624J02Rik	C	T	7: 118,794,577		probably null	Het
Abca7	T	A	10: 80,002,062	D488E	probably damaging	Het
Adora2a	A	G	10: 75,333,589	K296E	possibly damaging	Het
Atp13a4	T	A	16: 29,471,956	E225V		Het
Bpifb2	A	G	2: 153,889,477	M258V	possibly damaging	Het
Brd2	G	A	17: 34,122,257		probably benign	Het
Btaf1	G	T	19: 37,009,605	V1700F	probably damaging	Het
C2cd3	A	G	7: 100,427,226	I797V		Het
Ccdc148	T	G	2: 59,009,148	E71A	probably damaging	Het
Ccdc18	T	A	5: 108,206,617	L1074*	probably null	Het
Ccne2	A	G	4: 11,198,772	D215G	probably damaging	Het
Cers6	T	A	2: 68,861,807		probably null	Het
Copz1	A	G	15: 103,296,544	E110G	probably damaging	Het
Cped1	A	T	6: 22,215,513	D682V	probably damaging	Het
Crb1	A	T	1: 139,237,030	C1180S	probably damaging	Het
Echdc3	A	T	2: 6,189,557	L229Q	probably damaging	Het
Etfb	C	T	7: 43,454,576	P145L	probably damaging	Het
Exoc3l2	G	T	7: 19,469,888	R135L		Het
Fam83a	G	A	15: 57,986,173	A38T	probably damaging	Het
G6pc2	T	C	2: 69,223,000	Y133H	probably benign	Het
Gfy	T	C	7: 45,178,094	I193V	probably benign	Het
Ggnbp2	T	C	11: 84,854,073	T208A	probably benign	Het
Gigyf1	T	A	5: 137,525,533	M1019K	probably damaging	Het
Gm15922	T	C	7: 3,739,024	E119G	not run	Het
Gm45783	T	C	7: 7,370,600	D61G	probably damaging	Het
Golga5	T	C	12: 102,484,576		probably null	Het
Ighe	A	G	12: 113,271,403	V379A		Het
Itpr3	C	A	17: 27,094,800	H573Q	probably benign	Het
Klhl2	A	G	8: 64,749,775	L463P	probably damaging	Het
Limd1	T	A	9: 123,479,683	V149E	probably benign	Het
Lyz2	T	C	10: 117,282,239	K2E	probably damaging	Het
Man2c1	T	A	9: 57,141,128	S858T	probably damaging	Het
Nt5dc1	A	T	10: 34,304,936	N439K	probably benign	Het
Olfr1173	T	C	2: 88,275,101		probably benign	Het
Olfr1178	T	C	2: 88,391,880	V211A	possibly damaging	Het
Olfr1239	A	G	2: 89,417,801	I204T	probably benign	Het
Olfr566	A	T	7: 102,857,071	Y70*	probably null	Het
Olfr733	G	A	14: 50,298,824	L162F	probably benign	Het
Olfr845	A	C	9: 19,338,813	M118L	probably damaging	Het
Otogl	T	C	10: 107,886,982	N296S	probably benign	Het
Patj	A	G	4: 98,495,061	N789D	probably benign	Het
Pcsk6	A	G	7: 66,043,566	D851G	possibly damaging	Het
Peg3	T	C	7: 6,709,724	H833R	probably damaging	Het
Plekha5	A	G	6: 140,580,435	D933G	probably benign	Het
Pnma1	G	A	12: 84,147,129	R267C	probably damaging	Het
Ppp3cb	T	A	14: 20,508,551	H481L	probably benign	Het
Prl8a8	T	C	13: 27,511,435		probably null	Het
Ptma	GGAAGAAG	GGAAGAAGAAG	1: 86,529,539		probably benign	Het
Ptpro	C	A	6: 137,382,649	L406I	probably benign	Het
Rbpj	T	C	5: 53,600,934	S18P	probably benign	Het
Rhbg	C	T	3: 88,247,579	V173M	probably damaging	Het
Rps6kc1	A	G	1: 190,800,057	S583P	probably benign	Het
Ryr1	T	C	7: 29,095,205	S1217G	probably benign	Het
S1pr1	A	T	3: 115,712,273	I224N	probably damaging	Het
Sall1	C	T	8: 89,031,053	D808N	probably benign	Het
Shoc2	T	C	19: 53,988,036	V119A	probably benign	Het
Ssh2	A	T	11: 77,437,716	E369D	probably benign	Het
Stx1b	C	T	7: 127,807,359	V273M	possibly damaging	Het
Syne2	A	G	12: 75,965,880	H2615R	probably benign	Het
Tmc8	T	C	11: 117,784,932	I225T	probably benign	Het
Tmem126b	A	G	7: 90,472,646	I52T	probably benign	Het
Top2b	G	A	14: 16,416,605	D1122N	probably benign	Het
Trav13-2	T	A	14: 53,634,906	S7T	possibly damaging	Het
Ttc1	A	T	11: 43,745,362	L18Q	probably damaging	Het
Ttn	A	T	2: 76,737,209	I27780N	probably damaging	Het
Ubfd1	T	C	7: 122,067,412	S44P	probably benign	Het
Vmn1r89	A	G	7: 13,219,705	K123E	probably damaging	Het
Vmn2r62	A	C	7: 42,787,892	F389L	possibly damaging	Het
Zdhhc11	T	A	13: 73,973,607	M79K	possibly damaging	Het
Zfp202	G	T	9: 40,207,344	V18F	possibly damaging	Het
Zfp39	A	G	11: 58,891,043	F298L	possibly damaging	Het
Znrf1	G	A	8: 111,537,439	G100D	probably damaging	Het

Other mutations in Large1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Large1	APN	8	72837497	missense	probably damaging	1.00
IGL00326:Large1	APN	8	73131983	missense	probably benign
IGL00418:Large1	APN	8	72823841	critical splice acceptor site	probably null
IGL01155:Large1	APN	8	73131989	missense	probably benign	0.01
IGL01793:Large1	APN	8	72859181	splice site	probably benign
IGL01929:Large1	APN	8	72859275	missense	probably damaging	1.00
IGL02218:Large1	APN	8	72912122	missense	probably damaging	1.00
IGL02276:Large1	APN	8	72818093	missense	probably benign	0.00
IGL02329:Large1	APN	8	73048317	missense	possibly damaging	0.80
IGL02543:Large1	APN	8	73048414	missense	probably benign	0.00
IGL02887:Large1	APN	8	73132039	missense	probably benign	0.07
biggs	UTSW	8	73116419	missense	probably damaging	1.00
umber	UTSW	8	72883264	nonsense	probably null
R0179:Large1	UTSW	8	73098846	missense	probably benign	0.09
R0477:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R0587:Large1	UTSW	8	72859333	missense	probably damaging	1.00
R0791:Large1	UTSW	8	73048479	splice site	probably benign
R1253:Large1	UTSW	8	73048422	missense	probably damaging	0.98
R1695:Large1	UTSW	8	72818082	missense	probably damaging	1.00
R2017:Large1	UTSW	8	72852197	missense	probably damaging	1.00
R4835:Large1	UTSW	8	73048347	missense	probably damaging	1.00
R5105:Large1	UTSW	8	72852244	nonsense	probably null
R5120:Large1	UTSW	8	72859341	missense	probably damaging	1.00
R5135:Large1	UTSW	8	72818096	missense	probably benign	0.38
R5137:Large1	UTSW	8	73048309	missense	possibly damaging	0.58
R5567:Large1	UTSW	8	72837453	missense	possibly damaging	0.93
R5945:Large1	UTSW	8	72852200	missense	probably damaging	0.99
R6619:Large1	UTSW	8	72883264	nonsense	probably null
R6951:Large1	UTSW	8	73116419	missense	probably damaging	1.00
R7041:Large1	UTSW	8	73116464	missense	probably damaging	0.98
R7300:Large1	UTSW	8	72837596	missense	probably damaging	1.00
R7877:Large1	UTSW	8	73116443	missense	probably damaging	1.00
R8118:Large1	UTSW	8	73131944	missense	probably benign	0.40
R8129:Large1	UTSW	8	72815957	missense	probably damaging	1.00
R8525:Large1	UTSW	8	72837492	missense	probably damaging	1.00
R8963:Large1	UTSW	8	72815984	missense	probably damaging	1.00
R9170:Large1	UTSW	8	72816017	missense	probably benign	0.00
Z1088:Large1	UTSW	8	72912103	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGCGTCCCAAGGTCAAAGG -3'
(R):5'- TAGTTGCTTAGCCTCCCTGG -3'

Sequencing Primer
(F):5'- CAAGGTCAAAGGGCTGAGTATCTTTC -3'
(R):5'- TCAGCTATCCTCACAATGAAGGG -3'

Posted On

2019-10-17