Incidental Mutation 'R7493:Sall1'
ID580931
Institutional Source Beutler Lab
Gene Symbol Sall1
Ensembl Gene ENSMUSG00000031665
Gene Namespalt like transcription factor 1
SynonymsMsal-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R7493 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location89027235-89044162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89031053 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 808 (D808N)
Ref Sequence ENSEMBL: ENSMUSP00000034090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034090]
Predicted Effect probably benign
Transcript: ENSMUST00000034090
AA Change: D808N

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034090
Gene: ENSMUSG00000031665
AA Change: D808N

DomainStartEndE-ValueType
low complexity region 133 152 N/A INTRINSIC
low complexity region 163 175 N/A INTRINSIC
low complexity region 229 257 N/A INTRINSIC
low complexity region 283 309 N/A INTRINSIC
low complexity region 361 396 N/A INTRINSIC
ZnF_C2H2 450 472 2.57e-3 SMART
ZnF_C2H2 478 500 3.21e-4 SMART
low complexity region 547 569 N/A INTRINSIC
ZnF_C2H2 705 727 3.02e0 SMART
ZnF_C2H2 733 755 8.6e-5 SMART
ZnF_C2H2 765 787 1.6e-4 SMART
low complexity region 842 861 N/A INTRINSIC
ZnF_C2H2 1000 1022 2.91e-2 SMART
ZnF_C2H2 1028 1050 4.94e-5 SMART
ZnF_C2H2 1133 1155 1.38e-3 SMART
ZnF_C2H2 1161 1183 1.22e-4 SMART
low complexity region 1257 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcriptional repressor and may be part of the NuRD histone deacetylase complex (HDAC). Defects in this gene are a cause of Townes-Brocks syndrome (TBS) as well as bronchio-oto-renal syndrome (BOR). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit kidney agenesis or dysgenesis and die perinatally. Homozygotes expressing only a truncated protein show renal agenesis, exencephaly, and limb defects; heterozygotes have hearing loss and cystic kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,531 D122G probably benign Het
3110062M04Rik A T 6: 34,874,658 L114Q probably damaging Het
3425401B19Rik A G 14: 32,663,300 L236P possibly damaging Het
4932415D10Rik A T 10: 82,288,964 Y2737* probably null Het
4932415D10Rik T C 10: 82,316,430 Y34C unknown Het
9030624J02Rik C T 7: 118,794,577 probably null Het
Abca7 T A 10: 80,002,062 D488E probably damaging Het
Adora2a A G 10: 75,333,589 K296E possibly damaging Het
Atp13a4 T A 16: 29,471,956 E225V Het
Bpifb2 A G 2: 153,889,477 M258V possibly damaging Het
Brd2 G A 17: 34,122,257 probably benign Het
Btaf1 G T 19: 37,009,605 V1700F probably damaging Het
C2cd3 A G 7: 100,427,226 I797V Het
Ccdc148 T G 2: 59,009,148 E71A probably damaging Het
Ccdc18 T A 5: 108,206,617 L1074* probably null Het
Ccne2 A G 4: 11,198,772 D215G probably damaging Het
Cers6 T A 2: 68,861,807 probably null Het
Copz1 A G 15: 103,296,544 E110G probably damaging Het
Cped1 A T 6: 22,215,513 D682V probably damaging Het
Crb1 A T 1: 139,237,030 C1180S probably damaging Het
Echdc3 A T 2: 6,189,557 L229Q probably damaging Het
Etfb C T 7: 43,454,576 P145L probably damaging Het
Exoc3l2 G T 7: 19,469,888 R135L Het
Fam83a G A 15: 57,986,173 A38T probably damaging Het
G6pc2 T C 2: 69,223,000 Y133H probably benign Het
Gfy T C 7: 45,178,094 I193V probably benign Het
Ggnbp2 T C 11: 84,854,073 T208A probably benign Het
Gigyf1 T A 5: 137,525,533 M1019K probably damaging Het
Gm15922 T C 7: 3,739,024 E119G not run Het
Gm45783 T C 7: 7,370,600 D61G probably damaging Het
Golga5 T C 12: 102,484,576 probably null Het
Ighe A G 12: 113,271,403 V379A Het
Itpr3 C A 17: 27,094,800 H573Q probably benign Het
Klhl2 A G 8: 64,749,775 L463P probably damaging Het
Large1 T G 8: 72,823,715 M619L probably benign Het
Limd1 T A 9: 123,479,683 V149E probably benign Het
Lyz2 T C 10: 117,282,239 K2E probably damaging Het
Man2c1 T A 9: 57,141,128 S858T probably damaging Het
Nt5dc1 A T 10: 34,304,936 N439K probably benign Het
Olfr1173 T C 2: 88,275,101 probably benign Het
Olfr1178 T C 2: 88,391,880 V211A possibly damaging Het
Olfr1239 A G 2: 89,417,801 I204T probably benign Het
Olfr566 A T 7: 102,857,071 Y70* probably null Het
Olfr733 G A 14: 50,298,824 L162F probably benign Het
Olfr845 A C 9: 19,338,813 M118L probably damaging Het
Otogl T C 10: 107,886,982 N296S probably benign Het
Patj A G 4: 98,495,061 N789D probably benign Het
Pcsk6 A G 7: 66,043,566 D851G possibly damaging Het
Peg3 T C 7: 6,709,724 H833R probably damaging Het
Plekha5 A G 6: 140,580,435 D933G probably benign Het
Pnma1 G A 12: 84,147,129 R267C probably damaging Het
Ppp3cb T A 14: 20,508,551 H481L probably benign Het
Prl8a8 T C 13: 27,511,435 probably null Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptpro C A 6: 137,382,649 L406I probably benign Het
Rbpj T C 5: 53,600,934 S18P probably benign Het
Rhbg C T 3: 88,247,579 V173M probably damaging Het
Rps6kc1 A G 1: 190,800,057 S583P probably benign Het
Ryr1 T C 7: 29,095,205 S1217G probably benign Het
S1pr1 A T 3: 115,712,273 I224N probably damaging Het
Shoc2 T C 19: 53,988,036 V119A probably benign Het
Ssh2 A T 11: 77,437,716 E369D probably benign Het
Stx1b C T 7: 127,807,359 V273M possibly damaging Het
Syne2 A G 12: 75,965,880 H2615R probably benign Het
Tmc8 T C 11: 117,784,932 I225T probably benign Het
Tmem126b A G 7: 90,472,646 I52T probably benign Het
Top2b G A 14: 16,416,605 D1122N probably benign Het
Trav13-2 T A 14: 53,634,906 S7T possibly damaging Het
Ttc1 A T 11: 43,745,362 L18Q probably damaging Het
Ttn A T 2: 76,737,209 I27780N probably damaging Het
Ubfd1 T C 7: 122,067,412 S44P probably benign Het
Vmn1r89 A G 7: 13,219,705 K123E probably damaging Het
Vmn2r62 A C 7: 42,787,892 F389L possibly damaging Het
Zdhhc11 T A 13: 73,973,607 M79K possibly damaging Het
Zfp202 G T 9: 40,207,344 V18F possibly damaging Het
Zfp39 A G 11: 58,891,043 F298L possibly damaging Het
Znrf1 G A 8: 111,537,439 G100D probably damaging Het
Other mutations in Sall1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Sall1 APN 8 89033344 missense probably damaging 1.00
IGL01670:Sall1 APN 8 89031571 missense probably benign 0.01
IGL01795:Sall1 APN 8 89028680 missense probably benign 0.02
IGL02041:Sall1 APN 8 89031469 missense probably damaging 1.00
IGL02078:Sall1 APN 8 89030375 missense probably damaging 0.99
IGL02105:Sall1 APN 8 89032568 missense probably damaging 0.99
IGL02354:Sall1 APN 8 89033049 missense probably benign 0.10
IGL02727:Sall1 APN 8 89030755 missense probably damaging 1.00
IGL02943:Sall1 APN 8 89031121 missense probably damaging 0.99
IGL03179:Sall1 APN 8 89031661 missense probably benign 0.00
PIT4651001:Sall1 UTSW 8 89031103 missense probably damaging 1.00
R0089:Sall1 UTSW 8 89030268 missense probably benign 0.09
R0386:Sall1 UTSW 8 89032604 missense probably damaging 1.00
R0532:Sall1 UTSW 8 89033191 missense probably benign
R0555:Sall1 UTSW 8 89031758 missense probably benign 0.16
R1203:Sall1 UTSW 8 89031934 missense probably damaging 1.00
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1406:Sall1 UTSW 8 89032444 missense probably benign 0.34
R1449:Sall1 UTSW 8 89032483 missense probably benign
R1477:Sall1 UTSW 8 89032882 missense probably damaging 1.00
R1692:Sall1 UTSW 8 89028400 missense probably benign 0.00
R1839:Sall1 UTSW 8 89028716 missense possibly damaging 0.89
R2016:Sall1 UTSW 8 89028409 missense probably benign 0.10
R2041:Sall1 UTSW 8 89032801 missense probably benign
R3808:Sall1 UTSW 8 89031473 nonsense probably null
R3816:Sall1 UTSW 8 89032675 missense probably benign 0.00
R4085:Sall1 UTSW 8 89028509 missense probably benign
R4604:Sall1 UTSW 8 89030341 missense probably damaging 1.00
R4701:Sall1 UTSW 8 89031160 missense probably damaging 1.00
R5760:Sall1 UTSW 8 89028650 missense possibly damaging 0.94
R6091:Sall1 UTSW 8 89028619 missense probably damaging 1.00
R6213:Sall1 UTSW 8 89033058 small deletion probably benign
R6326:Sall1 UTSW 8 89030268 missense probably benign 0.09
R6920:Sall1 UTSW 8 89030393 missense probably damaging 1.00
R6954:Sall1 UTSW 8 89032891 missense probably damaging 1.00
R7395:Sall1 UTSW 8 89030921 missense possibly damaging 0.86
R7396:Sall1 UTSW 8 89032768 missense probably damaging 1.00
R7555:Sall1 UTSW 8 89033158 missense possibly damaging 0.90
R7672:Sall1 UTSW 8 89031299 missense probably damaging 0.99
R7759:Sall1 UTSW 8 89042351 critical splice donor site probably null
R7834:Sall1 UTSW 8 89033374 missense probably benign 0.42
R8023:Sall1 UTSW 8 89032543 missense probably damaging 0.99
R8166:Sall1 UTSW 8 89028518 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GATTTTCCAGAGCAGCGATG -3'
(R):5'- CAAGTGTAAGATCTGCGGCC -3'

Sequencing Primer
(F):5'- ACAGGCTATCTTGGGAAG -3'
(R):5'- GGCCGGGCTTTCACCAC -3'
Posted On2019-10-17