Incidental Mutation 'R7493:Abca7'
ID580939
Institutional Source Beutler Lab
Gene Symbol Abca7
Ensembl Gene ENSMUSG00000035722
Gene NameATP-binding cassette, sub-family A (ABC1), member 7
SynonymsAbc51
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7493 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79996494-80015572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80002062 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 488 (D488E)
Ref Sequence ENSEMBL: ENSMUSP00000128121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043866] [ENSMUST00000132517] [ENSMUST00000171637]
Predicted Effect probably damaging
Transcript: ENSMUST00000043866
AA Change: D488E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043090
Gene: ENSMUSG00000035722
AA Change: D488E

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132517
AA Change: D488E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115111
Gene: ENSMUSG00000035722
AA Change: D488E

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 515 747 1.1e-17 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1241 1263 N/A INTRINSIC
low complexity region 1299 1309 N/A INTRINSIC
low complexity region 1374 1390 N/A INTRINSIC
Pfam:ABC2_membrane_3 1427 1764 9e-43 PFAM
AAA 1833 2018 7.2e-9 SMART
low complexity region 2120 2135 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171637
AA Change: D488E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128121
Gene: ENSMUSG00000035722
AA Change: D488E

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 517 747 2.8e-19 PFAM
AAA 830 1011 4.97e-12 SMART
low complexity region 1136 1147 N/A INTRINSIC
transmembrane domain 1249 1271 N/A INTRINSIC
low complexity region 1307 1317 N/A INTRINSIC
low complexity region 1382 1398 N/A INTRINSIC
Pfam:ABC2_membrane_3 1426 1772 3.9e-47 PFAM
AAA 1841 2026 7.2e-9 SMART
low complexity region 2128 2143 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is widely expressed with highest detection in spleen and hematopoietic tissues. Defects in this gene cause an increase in amyloid-beta deposits in a mouse model of Alzheimer's disease, and a related human protein is thought to play a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous mutant females, but not males, have less white fat and lower total serum and HDL cholesterol levels. Males exhibit a 10% reduction in kidney size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,531 D122G probably benign Het
3110062M04Rik A T 6: 34,874,658 L114Q probably damaging Het
3425401B19Rik A G 14: 32,663,300 L236P possibly damaging Het
4932415D10Rik A T 10: 82,288,964 Y2737* probably null Het
4932415D10Rik T C 10: 82,316,430 Y34C unknown Het
9030624J02Rik C T 7: 118,794,577 probably null Het
Adora2a A G 10: 75,333,589 K296E possibly damaging Het
Atp13a4 T A 16: 29,471,956 E225V Het
Bpifb2 A G 2: 153,889,477 M258V possibly damaging Het
Brd2 G A 17: 34,122,257 probably benign Het
Btaf1 G T 19: 37,009,605 V1700F probably damaging Het
C2cd3 A G 7: 100,427,226 I797V Het
Ccdc148 T G 2: 59,009,148 E71A probably damaging Het
Ccdc18 T A 5: 108,206,617 L1074* probably null Het
Ccne2 A G 4: 11,198,772 D215G probably damaging Het
Cers6 T A 2: 68,861,807 probably null Het
Copz1 A G 15: 103,296,544 E110G probably damaging Het
Cped1 A T 6: 22,215,513 D682V probably damaging Het
Crb1 A T 1: 139,237,030 C1180S probably damaging Het
Echdc3 A T 2: 6,189,557 L229Q probably damaging Het
Etfb C T 7: 43,454,576 P145L probably damaging Het
Exoc3l2 G T 7: 19,469,888 R135L Het
Fam83a G A 15: 57,986,173 A38T probably damaging Het
G6pc2 T C 2: 69,223,000 Y133H probably benign Het
Gfy T C 7: 45,178,094 I193V probably benign Het
Ggnbp2 T C 11: 84,854,073 T208A probably benign Het
Gigyf1 T A 5: 137,525,533 M1019K probably damaging Het
Gm15922 T C 7: 3,739,024 E119G not run Het
Gm45783 T C 7: 7,370,600 D61G probably damaging Het
Golga5 T C 12: 102,484,576 probably null Het
Ighe A G 12: 113,271,403 V379A Het
Itpr3 C A 17: 27,094,800 H573Q probably benign Het
Klhl2 A G 8: 64,749,775 L463P probably damaging Het
Large1 T G 8: 72,823,715 M619L probably benign Het
Limd1 T A 9: 123,479,683 V149E probably benign Het
Lyz2 T C 10: 117,282,239 K2E probably damaging Het
Man2c1 T A 9: 57,141,128 S858T probably damaging Het
Nt5dc1 A T 10: 34,304,936 N439K probably benign Het
Olfr1173 T C 2: 88,275,101 probably benign Het
Olfr1178 T C 2: 88,391,880 V211A possibly damaging Het
Olfr1239 A G 2: 89,417,801 I204T probably benign Het
Olfr566 A T 7: 102,857,071 Y70* probably null Het
Olfr733 G A 14: 50,298,824 L162F probably benign Het
Olfr845 A C 9: 19,338,813 M118L probably damaging Het
Otogl T C 10: 107,886,982 N296S probably benign Het
Patj A G 4: 98,495,061 N789D probably benign Het
Pcsk6 A G 7: 66,043,566 D851G possibly damaging Het
Peg3 T C 7: 6,709,724 H833R probably damaging Het
Plekha5 A G 6: 140,580,435 D933G probably benign Het
Pnma1 G A 12: 84,147,129 R267C probably damaging Het
Ppp3cb T A 14: 20,508,551 H481L probably benign Het
Prl8a8 T C 13: 27,511,435 probably null Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptpro C A 6: 137,382,649 L406I probably benign Het
Rbpj T C 5: 53,600,934 S18P probably benign Het
Rhbg C T 3: 88,247,579 V173M probably damaging Het
Rps6kc1 A G 1: 190,800,057 S583P probably benign Het
Ryr1 T C 7: 29,095,205 S1217G probably benign Het
S1pr1 A T 3: 115,712,273 I224N probably damaging Het
Sall1 C T 8: 89,031,053 D808N probably benign Het
Shoc2 T C 19: 53,988,036 V119A probably benign Het
Ssh2 A T 11: 77,437,716 E369D probably benign Het
Stx1b C T 7: 127,807,359 V273M possibly damaging Het
Syne2 A G 12: 75,965,880 H2615R probably benign Het
Tmc8 T C 11: 117,784,932 I225T probably benign Het
Tmem126b A G 7: 90,472,646 I52T probably benign Het
Top2b G A 14: 16,416,605 D1122N probably benign Het
Trav13-2 T A 14: 53,634,906 S7T possibly damaging Het
Ttc1 A T 11: 43,745,362 L18Q probably damaging Het
Ttn A T 2: 76,737,209 I27780N probably damaging Het
Ubfd1 T C 7: 122,067,412 S44P probably benign Het
Vmn1r89 A G 7: 13,219,705 K123E probably damaging Het
Vmn2r62 A C 7: 42,787,892 F389L possibly damaging Het
Zdhhc11 T A 13: 73,973,607 M79K possibly damaging Het
Zfp202 G T 9: 40,207,344 V18F possibly damaging Het
Zfp39 A G 11: 58,891,043 F298L possibly damaging Het
Znrf1 G A 8: 111,537,439 G100D probably damaging Het
Other mutations in Abca7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Abca7 APN 10 80011297 missense probably damaging 0.96
IGL01074:Abca7 APN 10 80013892 missense possibly damaging 0.88
IGL01313:Abca7 APN 10 80003123 splice site probably benign
IGL01372:Abca7 APN 10 80006255 missense probably benign 0.00
IGL01387:Abca7 APN 10 79999762 missense possibly damaging 0.71
IGL01468:Abca7 APN 10 80003877 missense probably benign 0.21
IGL01648:Abca7 APN 10 80011080 missense probably damaging 1.00
IGL01796:Abca7 APN 10 80013909 missense probably damaging 0.99
IGL01977:Abca7 APN 10 80006152 missense probably benign 0.31
IGL01982:Abca7 APN 10 80002641 missense probably damaging 1.00
IGL02115:Abca7 APN 10 79998079 missense probably damaging 1.00
IGL02437:Abca7 APN 10 80008389 missense probably damaging 1.00
IGL02721:Abca7 APN 10 80013635 missense possibly damaging 0.93
IGL02812:Abca7 APN 10 80006047 missense possibly damaging 0.84
IGL02823:Abca7 APN 10 80008822 missense probably damaging 1.00
IGL02827:Abca7 APN 10 80009865 missense probably damaging 1.00
IGL02897:Abca7 APN 10 80001592 missense probably damaging 1.00
IGL02952:Abca7 APN 10 80007408 missense probably damaging 1.00
R0507:Abca7 UTSW 10 80002821 splice site probably benign
R0528:Abca7 UTSW 10 80003014 missense probably damaging 1.00
R0541:Abca7 UTSW 10 80007351 missense probably benign 0.01
R0584:Abca7 UTSW 10 80011730 missense probably damaging 1.00
R1018:Abca7 UTSW 10 80001491 missense probably damaging 1.00
R1099:Abca7 UTSW 10 80013743 nonsense probably null
R1520:Abca7 UTSW 10 80008830 missense possibly damaging 0.69
R1536:Abca7 UTSW 10 80014230 missense probably benign 0.39
R1619:Abca7 UTSW 10 80009055 missense probably damaging 1.00
R1636:Abca7 UTSW 10 80008998 missense probably benign
R1752:Abca7 UTSW 10 80006634 missense probably benign 0.17
R1762:Abca7 UTSW 10 79999765 missense probably damaging 1.00
R1764:Abca7 UTSW 10 80008950 missense probably damaging 1.00
R1891:Abca7 UTSW 10 80005040 missense possibly damaging 0.72
R1911:Abca7 UTSW 10 80006634 missense probably benign 0.17
R2032:Abca7 UTSW 10 80008237 missense probably damaging 1.00
R2188:Abca7 UTSW 10 80002533 missense probably damaging 1.00
R2973:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R2974:Abca7 UTSW 10 80008967 missense probably damaging 1.00
R3055:Abca7 UTSW 10 79999747 missense probably damaging 1.00
R4496:Abca7 UTSW 10 80002934 missense probably damaging 1.00
R4570:Abca7 UTSW 10 80006694 missense probably damaging 1.00
R4581:Abca7 UTSW 10 80006568 missense probably benign 0.03
R4588:Abca7 UTSW 10 79997867 splice site probably null
R4628:Abca7 UTSW 10 80015188 critical splice donor site probably null
R4641:Abca7 UTSW 10 80005781 critical splice donor site probably null
R4888:Abca7 UTSW 10 80002728 missense probably damaging 0.97
R4911:Abca7 UTSW 10 80012188 critical splice donor site probably null
R4979:Abca7 UTSW 10 80004783 nonsense probably null
R4997:Abca7 UTSW 10 80007320 missense possibly damaging 0.90
R5147:Abca7 UTSW 10 80015315 missense probably benign 0.02
R5176:Abca7 UTSW 10 79998289 missense probably benign 0.35
R5190:Abca7 UTSW 10 79999593 critical splice donor site probably null
R5358:Abca7 UTSW 10 80013331 missense probably damaging 0.99
R5409:Abca7 UTSW 10 80014320 missense probably damaging 1.00
R5705:Abca7 UTSW 10 80015442 missense probably benign
R6246:Abca7 UTSW 10 80015165 missense probably damaging 1.00
R6256:Abca7 UTSW 10 80002622 missense probably damaging 1.00
R6260:Abca7 UTSW 10 80008987 missense probably damaging 1.00
R6275:Abca7 UTSW 10 79997791 missense probably damaging 1.00
R6277:Abca7 UTSW 10 80006158 missense probably benign 0.04
R6284:Abca7 UTSW 10 80004410 missense probably benign
R6307:Abca7 UTSW 10 80007387 missense probably damaging 1.00
R6451:Abca7 UTSW 10 80006899 missense probably damaging 0.99
R6456:Abca7 UTSW 10 80015150 missense probably null 0.69
R6460:Abca7 UTSW 10 80009028 missense probably benign 0.04
R6560:Abca7 UTSW 10 80007396 missense probably damaging 1.00
R6565:Abca7 UTSW 10 80011788 missense probably damaging 1.00
R6644:Abca7 UTSW 10 80008764 missense probably damaging 0.98
R6814:Abca7 UTSW 10 80002999 missense probably damaging 1.00
R7289:Abca7 UTSW 10 80009944 missense probably damaging 1.00
R7303:Abca7 UTSW 10 80014988 missense probably benign 0.17
R7535:Abca7 UTSW 10 80001629 missense probably benign 0.04
R7602:Abca7 UTSW 10 79998012 critical splice acceptor site probably null
R7607:Abca7 UTSW 10 80011833 missense probably damaging 1.00
R7647:Abca7 UTSW 10 80000822 missense probably benign 0.00
R7821:Abca7 UTSW 10 80002590 small deletion probably benign
R7863:Abca7 UTSW 10 80008821 missense probably damaging 1.00
R7896:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7911:Abca7 UTSW 10 80005033 missense probably benign 0.00
R7946:Abca7 UTSW 10 80008821 missense probably damaging 1.00
R7979:Abca7 UTSW 10 80004958 missense probably damaging 1.00
R7992:Abca7 UTSW 10 80005033 missense probably benign 0.00
Z1176:Abca7 UTSW 10 79999432 nonsense probably null
Z1176:Abca7 UTSW 10 80006559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATGGGGTTGTGGCCAAG -3'
(R):5'- CAGGTTGCAAGGTACTCTCAC -3'

Sequencing Primer
(F):5'- CCTAGTACAAAGAGAGGGACTTTCC -3'
(R):5'- GGTTGCAAGGTACTCTCACACATC -3'
Posted On2019-10-17