Incidental Mutation 'R7493:Tmc8'
ID580948
Institutional Source Beutler Lab
Gene Symbol Tmc8
Ensembl Gene ENSMUSG00000050106
Gene Nametransmembrane channel-like gene family 8
SynonymsEver2, EVIN2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7493 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location117782076-117793110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117784932 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 225 (I225T)
Ref Sequence ENSEMBL: ENSMUSP00000101941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026659] [ENSMUST00000050874] [ENSMUST00000103025] [ENSMUST00000106334] [ENSMUST00000117781] [ENSMUST00000119455] [ENSMUST00000127080] [ENSMUST00000127227] [ENSMUST00000136729] [ENSMUST00000152304]
Predicted Effect probably benign
Transcript: ENSMUST00000026659
SMART Domains Protein: ENSMUSP00000026659
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
transmembrane domain 338 360 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 489 N/A INTRINSIC
Pfam:TMC 539 645 1.5e-40 PFAM
transmembrane domain 650 672 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050874
AA Change: I224T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051878
Gene: ENSMUSG00000050106
AA Change: I224T

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 3.1e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103025
SMART Domains Protein: ENSMUSP00000099314
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 106 116 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106334
AA Change: I225T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101941
Gene: ENSMUSG00000050106
AA Change: I225T

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 6e-41 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117781
AA Change: I224T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113570
Gene: ENSMUSG00000050106
AA Change: I224T

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 301 323 N/A INTRINSIC
transmembrane domain 376 398 N/A INTRINSIC
Pfam:TMC 422 532 1.2e-42 PFAM
transmembrane domain 536 558 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
low complexity region 650 666 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
low complexity region 689 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119455
AA Change: I225T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113628
Gene: ENSMUSG00000050106
AA Change: I225T

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 204 226 N/A INTRINSIC
transmembrane domain 302 324 N/A INTRINSIC
transmembrane domain 377 399 N/A INTRINSIC
Pfam:TMC 423 533 2.5e-42 PFAM
transmembrane domain 537 559 N/A INTRINSIC
transmembrane domain 598 620 N/A INTRINSIC
low complexity region 651 667 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
low complexity region 690 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127080
SMART Domains Protein: ENSMUSP00000115270
Gene: ENSMUSG00000050106

DomainStartEndE-ValueType
transmembrane domain 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127227
Predicted Effect probably benign
Transcript: ENSMUST00000136729
SMART Domains Protein: ENSMUSP00000118068
Gene: ENSMUSG00000025572

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152304
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Epidermodysplasia verruciformis (EV) is an autosomal recessive dermatosis characterized by abnormal susceptibility to human papillomaviruses (HPVs) and a high rate of progression to squamous cell carcinoma on sun-exposed skin. EV is caused by mutations in either of two adjacent genes located on chromosome 17q25.3. Both of these genes encode integral membrane proteins that localize to the endoplasmic reticulum and are predicted to form transmembrane channels. This gene encodes a transmembrane channel-like protein with 8 predicted transmembrane domains and 3 leucine zipper motifs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,531 D122G probably benign Het
3110062M04Rik A T 6: 34,874,658 L114Q probably damaging Het
3425401B19Rik A G 14: 32,663,300 L236P possibly damaging Het
4932415D10Rik A T 10: 82,288,964 Y2737* probably null Het
4932415D10Rik T C 10: 82,316,430 Y34C unknown Het
9030624J02Rik C T 7: 118,794,577 probably null Het
Abca7 T A 10: 80,002,062 D488E probably damaging Het
Adora2a A G 10: 75,333,589 K296E possibly damaging Het
Atp13a4 T A 16: 29,471,956 E225V Het
Bpifb2 A G 2: 153,889,477 M258V possibly damaging Het
Brd2 G A 17: 34,122,257 probably benign Het
Btaf1 G T 19: 37,009,605 V1700F probably damaging Het
C2cd3 A G 7: 100,427,226 I797V Het
Ccdc148 T G 2: 59,009,148 E71A probably damaging Het
Ccdc18 T A 5: 108,206,617 L1074* probably null Het
Ccne2 A G 4: 11,198,772 D215G probably damaging Het
Cers6 T A 2: 68,861,807 probably null Het
Copz1 A G 15: 103,296,544 E110G probably damaging Het
Cped1 A T 6: 22,215,513 D682V probably damaging Het
Crb1 A T 1: 139,237,030 C1180S probably damaging Het
Echdc3 A T 2: 6,189,557 L229Q probably damaging Het
Etfb C T 7: 43,454,576 P145L probably damaging Het
Exoc3l2 G T 7: 19,469,888 R135L Het
Fam83a G A 15: 57,986,173 A38T probably damaging Het
G6pc2 T C 2: 69,223,000 Y133H probably benign Het
Gfy T C 7: 45,178,094 I193V probably benign Het
Ggnbp2 T C 11: 84,854,073 T208A probably benign Het
Gigyf1 T A 5: 137,525,533 M1019K probably damaging Het
Gm15922 T C 7: 3,739,024 E119G not run Het
Gm45783 T C 7: 7,370,600 D61G probably damaging Het
Golga5 T C 12: 102,484,576 probably null Het
Ighe A G 12: 113,271,403 V379A Het
Itpr3 C A 17: 27,094,800 H573Q probably benign Het
Klhl2 A G 8: 64,749,775 L463P probably damaging Het
Large1 T G 8: 72,823,715 M619L probably benign Het
Limd1 T A 9: 123,479,683 V149E probably benign Het
Lyz2 T C 10: 117,282,239 K2E probably damaging Het
Man2c1 T A 9: 57,141,128 S858T probably damaging Het
Nt5dc1 A T 10: 34,304,936 N439K probably benign Het
Olfr1173 T C 2: 88,275,101 probably benign Het
Olfr1178 T C 2: 88,391,880 V211A possibly damaging Het
Olfr1239 A G 2: 89,417,801 I204T probably benign Het
Olfr566 A T 7: 102,857,071 Y70* probably null Het
Olfr733 G A 14: 50,298,824 L162F probably benign Het
Olfr845 A C 9: 19,338,813 M118L probably damaging Het
Otogl T C 10: 107,886,982 N296S probably benign Het
Patj A G 4: 98,495,061 N789D probably benign Het
Pcsk6 A G 7: 66,043,566 D851G possibly damaging Het
Peg3 T C 7: 6,709,724 H833R probably damaging Het
Plekha5 A G 6: 140,580,435 D933G probably benign Het
Pnma1 G A 12: 84,147,129 R267C probably damaging Het
Ppp3cb T A 14: 20,508,551 H481L probably benign Het
Prl8a8 T C 13: 27,511,435 probably null Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptpro C A 6: 137,382,649 L406I probably benign Het
Rbpj T C 5: 53,600,934 S18P probably benign Het
Rhbg C T 3: 88,247,579 V173M probably damaging Het
Rps6kc1 A G 1: 190,800,057 S583P probably benign Het
Ryr1 T C 7: 29,095,205 S1217G probably benign Het
S1pr1 A T 3: 115,712,273 I224N probably damaging Het
Sall1 C T 8: 89,031,053 D808N probably benign Het
Shoc2 T C 19: 53,988,036 V119A probably benign Het
Ssh2 A T 11: 77,437,716 E369D probably benign Het
Stx1b C T 7: 127,807,359 V273M possibly damaging Het
Syne2 A G 12: 75,965,880 H2615R probably benign Het
Tmem126b A G 7: 90,472,646 I52T probably benign Het
Top2b G A 14: 16,416,605 D1122N probably benign Het
Trav13-2 T A 14: 53,634,906 S7T possibly damaging Het
Ttc1 A T 11: 43,745,362 L18Q probably damaging Het
Ttn A T 2: 76,737,209 I27780N probably damaging Het
Ubfd1 T C 7: 122,067,412 S44P probably benign Het
Vmn1r89 A G 7: 13,219,705 K123E probably damaging Het
Vmn2r62 A C 7: 42,787,892 F389L possibly damaging Het
Zdhhc11 T A 13: 73,973,607 M79K possibly damaging Het
Zfp202 G T 9: 40,207,344 V18F possibly damaging Het
Zfp39 A G 11: 58,891,043 F298L possibly damaging Het
Znrf1 G A 8: 111,537,439 G100D probably damaging Het
Other mutations in Tmc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Tmc8 APN 11 117786504 missense probably damaging 1.00
IGL01098:Tmc8 APN 11 117792563 missense possibly damaging 0.47
IGL01403:Tmc8 APN 11 117791074 missense possibly damaging 0.94
IGL01526:Tmc8 APN 11 117792084 splice site probably benign
IGL02045:Tmc8 APN 11 117786520 missense probably damaging 1.00
IGL02138:Tmc8 APN 11 117791255 missense probably benign 0.01
IGL02581:Tmc8 APN 11 117783888 missense probably benign 0.01
IGL02685:Tmc8 APN 11 117792574 missense probably damaging 0.96
R0241:Tmc8 UTSW 11 117786381 unclassified probably benign
R0485:Tmc8 UTSW 11 117792078 splice site probably benign
R1168:Tmc8 UTSW 11 117792563 missense possibly damaging 0.47
R1701:Tmc8 UTSW 11 117791362 splice site probably null
R2425:Tmc8 UTSW 11 117792569 missense probably damaging 0.96
R2509:Tmc8 UTSW 11 117792685 missense possibly damaging 0.66
R4747:Tmc8 UTSW 11 117792724 missense probably benign 0.27
R4783:Tmc8 UTSW 11 117791605 splice site probably null
R5821:Tmc8 UTSW 11 117792629 nonsense probably null
R5923:Tmc8 UTSW 11 117783812 missense probably damaging 1.00
R6381:Tmc8 UTSW 11 117791600 missense probably null 0.73
R6712:Tmc8 UTSW 11 117784813 missense probably benign 0.43
R7351:Tmc8 UTSW 11 117783828 missense probably damaging 1.00
R7818:Tmc8 UTSW 11 117792127 missense probably damaging 1.00
RF021:Tmc8 UTSW 11 117783234 missense probably benign 0.00
Z1176:Tmc8 UTSW 11 117786409 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCAGGGCAAGCACTTCAG -3'
(R):5'- AGAACACTTTGGCGCTGAGG -3'

Sequencing Primer
(F):5'- AAGCACTTCAGGGCCCTG -3'
(R):5'- TGACCCAAGAGTGTCTGCTG -3'
Posted On2019-10-17