Mutagenetix > Incidental Mutation

Incidental Mutation 'R7493:Top2b'

580955

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R7493 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 16416605 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1122 (D1122N)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]

AlphaFold

Q64511

Predicted Effect

probably benign
Transcript: ENSMUST00000017629
AA Change: D1122N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: D1122N

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485
AA Change: D168N

Domain	Start	End	E-Value	Type
TOP4c	2	222	3.97e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000161693
AA Change: D61N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485
AA Change: D61N

Domain	Start	End	E-Value	Type
Pfam:DNA_topoisoIV	1	117	1.2e-12	PFAM
low complexity region	161	173	N/A	INTRINSIC
low complexity region	198	210	N/A	INTRINSIC
low complexity region	234	256	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,015,531	D122G	probably benign	Het
3110062M04Rik	A	T	6: 34,874,658	L114Q	probably damaging	Het
3425401B19Rik	A	G	14: 32,663,300	L236P	possibly damaging	Het
4932415D10Rik	A	T	10: 82,288,964	Y2737*	probably null	Het
4932415D10Rik	T	C	10: 82,316,430	Y34C	unknown	Het
9030624J02Rik	C	T	7: 118,794,577		probably null	Het
Abca7	T	A	10: 80,002,062	D488E	probably damaging	Het
Adora2a	A	G	10: 75,333,589	K296E	possibly damaging	Het
Atp13a4	T	A	16: 29,471,956	E225V		Het
Bpifb2	A	G	2: 153,889,477	M258V	possibly damaging	Het
Brd2	G	A	17: 34,122,257		probably benign	Het
Btaf1	G	T	19: 37,009,605	V1700F	probably damaging	Het
C2cd3	A	G	7: 100,427,226	I797V		Het
Ccdc148	T	G	2: 59,009,148	E71A	probably damaging	Het
Ccdc18	T	A	5: 108,206,617	L1074*	probably null	Het
Ccne2	A	G	4: 11,198,772	D215G	probably damaging	Het
Cers6	T	A	2: 68,861,807		probably null	Het
Copz1	A	G	15: 103,296,544	E110G	probably damaging	Het
Cped1	A	T	6: 22,215,513	D682V	probably damaging	Het
Crb1	A	T	1: 139,237,030	C1180S	probably damaging	Het
Echdc3	A	T	2: 6,189,557	L229Q	probably damaging	Het
Etfb	C	T	7: 43,454,576	P145L	probably damaging	Het
Exoc3l2	G	T	7: 19,469,888	R135L		Het
Fam83a	G	A	15: 57,986,173	A38T	probably damaging	Het
G6pc2	T	C	2: 69,223,000	Y133H	probably benign	Het
Gfy	T	C	7: 45,178,094	I193V	probably benign	Het
Ggnbp2	T	C	11: 84,854,073	T208A	probably benign	Het
Gigyf1	T	A	5: 137,525,533	M1019K	probably damaging	Het
Gm15922	T	C	7: 3,739,024	E119G	not run	Het
Gm45783	T	C	7: 7,370,600	D61G	probably damaging	Het
Golga5	T	C	12: 102,484,576		probably null	Het
Ighe	A	G	12: 113,271,403	V379A		Het
Itpr3	C	A	17: 27,094,800	H573Q	probably benign	Het
Klhl2	A	G	8: 64,749,775	L463P	probably damaging	Het
Large1	T	G	8: 72,823,715	M619L	probably benign	Het
Limd1	T	A	9: 123,479,683	V149E	probably benign	Het
Lyz2	T	C	10: 117,282,239	K2E	probably damaging	Het
Man2c1	T	A	9: 57,141,128	S858T	probably damaging	Het
Nt5dc1	A	T	10: 34,304,936	N439K	probably benign	Het
Olfr1173	T	C	2: 88,275,101		probably benign	Het
Olfr1178	T	C	2: 88,391,880	V211A	possibly damaging	Het
Olfr1239	A	G	2: 89,417,801	I204T	probably benign	Het
Olfr566	A	T	7: 102,857,071	Y70*	probably null	Het
Olfr733	G	A	14: 50,298,824	L162F	probably benign	Het
Olfr845	A	C	9: 19,338,813	M118L	probably damaging	Het
Otogl	T	C	10: 107,886,982	N296S	probably benign	Het
Patj	A	G	4: 98,495,061	N789D	probably benign	Het
Pcsk6	A	G	7: 66,043,566	D851G	possibly damaging	Het
Peg3	T	C	7: 6,709,724	H833R	probably damaging	Het
Plekha5	A	G	6: 140,580,435	D933G	probably benign	Het
Pnma1	G	A	12: 84,147,129	R267C	probably damaging	Het
Ppp3cb	T	A	14: 20,508,551	H481L	probably benign	Het
Prl8a8	T	C	13: 27,511,435		probably null	Het
Ptma	GGAAGAAG	GGAAGAAGAAG	1: 86,529,539		probably benign	Het
Ptpro	C	A	6: 137,382,649	L406I	probably benign	Het
Rbpj	T	C	5: 53,600,934	S18P	probably benign	Het
Rhbg	C	T	3: 88,247,579	V173M	probably damaging	Het
Rps6kc1	A	G	1: 190,800,057	S583P	probably benign	Het
Ryr1	T	C	7: 29,095,205	S1217G	probably benign	Het
S1pr1	A	T	3: 115,712,273	I224N	probably damaging	Het
Sall1	C	T	8: 89,031,053	D808N	probably benign	Het
Shoc2	T	C	19: 53,988,036	V119A	probably benign	Het
Ssh2	A	T	11: 77,437,716	E369D	probably benign	Het
Stx1b	C	T	7: 127,807,359	V273M	possibly damaging	Het
Syne2	A	G	12: 75,965,880	H2615R	probably benign	Het
Tmc8	T	C	11: 117,784,932	I225T	probably benign	Het
Tmem126b	A	G	7: 90,472,646	I52T	probably benign	Het
Trav13-2	T	A	14: 53,634,906	S7T	possibly damaging	Het
Ttc1	A	T	11: 43,745,362	L18Q	probably damaging	Het
Ttn	A	T	2: 76,737,209	I27780N	probably damaging	Het
Ubfd1	T	C	7: 122,067,412	S44P	probably benign	Het
Vmn1r89	A	G	7: 13,219,705	K123E	probably damaging	Het
Vmn2r62	A	C	7: 42,787,892	F389L	possibly damaging	Het
Zdhhc11	T	A	13: 73,973,607	M79K	possibly damaging	Het
Zfp202	G	T	9: 40,207,344	V18F	possibly damaging	Het
Zfp39	A	G	11: 58,891,043	F298L	possibly damaging	Het
Znrf1	G	A	8: 111,537,439	G100D	probably damaging	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R4899:Top2b	UTSW	14	16387313	missense	probably damaging	1.00
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCAGTTTGGGACTTAGGAAAGC -3'
(R):5'- GAGATCATTAACCTCTCGCCC -3'

Sequencing Primer
(F):5'- GTTTGGGACTTAGGAAAGCAATTAAC -3'
(R):5'- TCGCCCCTACAATTGAAAGAGAGAG -3'

Posted On

2019-10-17