Incidental Mutation 'R7493:Shoc2'
ID580966
Institutional Source Beutler Lab
Gene Symbol Shoc2
Ensembl Gene ENSMUSG00000024976
Gene Namesoc-2 (suppressor of clear) homolog (C. elegans)
SynonymsSur-8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7493 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location53944306-54033268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53988036 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 119 (V119A)
Ref Sequence ENSEMBL: ENSMUSP00000025932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025932] [ENSMUST00000169861]
Predicted Effect probably benign
Transcript: ENSMUST00000025932
AA Change: V119A

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025932
Gene: ENSMUSG00000024976
AA Change: V119A

DomainStartEndE-ValueType
low complexity region 35 60 N/A INTRINSIC
LRR 122 144 1.33e-1 SMART
LRR 145 167 6.05e0 SMART
LRR 168 190 4.7e0 SMART
LRR 191 213 7.57e0 SMART
LRR 214 235 3.55e1 SMART
LRR_TYP 237 260 1.1e-2 SMART
low complexity region 266 278 N/A INTRINSIC
LRR 283 306 1.62e0 SMART
LRR 307 329 3.97e0 SMART
LRR 330 353 1.12e2 SMART
LRR 354 377 1.22e2 SMART
LRR 401 423 8.73e1 SMART
LRR 424 446 4.34e-1 SMART
LRR 447 469 4.65e-1 SMART
LRR 470 492 8.09e-1 SMART
LRR 493 514 2.82e0 SMART
LRR 516 540 5.89e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169861
AA Change: V119A

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127932
Gene: ENSMUSG00000024976
AA Change: V119A

DomainStartEndE-ValueType
low complexity region 35 60 N/A INTRINSIC
LRR 122 144 1.33e-1 SMART
LRR 145 167 6.05e0 SMART
LRR 168 190 4.7e0 SMART
LRR 191 213 7.57e0 SMART
LRR 214 235 3.55e1 SMART
LRR_TYP 237 260 1.1e-2 SMART
low complexity region 266 278 N/A INTRINSIC
LRR 283 306 1.62e0 SMART
LRR 307 329 3.97e0 SMART
LRR 330 353 1.12e2 SMART
LRR 354 377 1.22e2 SMART
LRR 401 423 8.73e1 SMART
LRR 424 446 4.34e-1 SMART
LRR 447 469 4.65e-1 SMART
LRR 470 492 8.09e-1 SMART
LRR 493 514 2.82e0 SMART
LRR 516 540 5.89e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that consists almost entirely of leucine-rich repeats, a domain implicated in protein-protein interactions. The protein may function as a scaffold linking RAS to downstream signal transducers in the RAS/ERK MAP kinase signaling cascade. Mutations in this gene have been associated with Noonan-like syndrome with loose anagen hair. [provided by RefSeq, May 2010]
PHENOTYPE: Shoc2 is essential for embryonic development, as germline deletion results in early embryonic lethality. Endothelial cell-specific deletion causes defects in cardiac development, and results in late embryonic/early fetal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,531 D122G probably benign Het
3110062M04Rik A T 6: 34,874,658 L114Q probably damaging Het
3425401B19Rik A G 14: 32,663,300 L236P possibly damaging Het
4932415D10Rik A T 10: 82,288,964 Y2737* probably null Het
4932415D10Rik T C 10: 82,316,430 Y34C unknown Het
Abca7 T A 10: 80,002,062 D488E probably damaging Het
Adora2a A G 10: 75,333,589 K296E possibly damaging Het
Atp13a4 T A 16: 29,471,956 E225V Het
Bpifb2 A G 2: 153,889,477 M258V possibly damaging Het
Brd2 G A 17: 34,122,257 probably benign Het
Btaf1 G T 19: 37,009,605 V1700F probably damaging Het
C2cd3 A G 7: 100,427,226 I797V Het
Ccdc148 T G 2: 59,009,148 E71A probably damaging Het
Ccdc18 T A 5: 108,206,617 L1074* probably null Het
Ccne2 A G 4: 11,198,772 D215G probably damaging Het
Cers6 T A 2: 68,861,807 probably null Het
Copz1 A G 15: 103,296,544 E110G probably damaging Het
Cped1 A T 6: 22,215,513 D682V probably damaging Het
Crb1 A T 1: 139,237,030 C1180S probably damaging Het
Echdc3 A T 2: 6,189,557 L229Q probably damaging Het
Etfb C T 7: 43,454,576 P145L probably damaging Het
Exoc3l2 G T 7: 19,469,888 R135L Het
Fam83a G A 15: 57,986,173 A38T probably damaging Het
G6pc2 T C 2: 69,223,000 Y133H probably benign Het
Gfy T C 7: 45,178,094 I193V probably benign Het
Ggnbp2 T C 11: 84,854,073 T208A probably benign Het
Gigyf1 T A 5: 137,525,533 M1019K probably damaging Het
Gm15922 T C 7: 3,739,024 E119G not run Het
Gm45783 T C 7: 7,370,600 D61G probably damaging Het
Golga5 T C 12: 102,484,576 probably null Het
Ighe A G 12: 113,271,403 V379A Het
Itpr3 C A 17: 27,094,800 H573Q probably benign Het
Klhl2 A G 8: 64,749,775 L463P probably damaging Het
Large1 T G 8: 72,823,715 M619L probably benign Het
Limd1 T A 9: 123,479,683 V149E probably benign Het
Lyz2 T C 10: 117,282,239 K2E probably damaging Het
Man2c1 T A 9: 57,141,128 S858T probably damaging Het
Nt5dc1 A T 10: 34,304,936 N439K probably benign Het
Olfr1173 T C 2: 88,275,101 probably benign Het
Olfr1178 T C 2: 88,391,880 V211A possibly damaging Het
Olfr1239 A G 2: 89,417,801 I204T probably benign Het
Olfr566 A T 7: 102,857,071 Y70* probably null Het
Olfr733 G A 14: 50,298,824 L162F probably benign Het
Olfr845 A C 9: 19,338,813 M118L probably damaging Het
Otogl T C 10: 107,886,982 N296S probably benign Het
Patj A G 4: 98,495,061 N789D probably benign Het
Pcsk6 A G 7: 66,043,566 D851G possibly damaging Het
Peg3 T C 7: 6,709,724 H833R probably damaging Het
Plekha5 A G 6: 140,580,435 D933G probably benign Het
Pnma1 G A 12: 84,147,129 R267C probably damaging Het
Ppp3cb T A 14: 20,508,551 H481L probably benign Het
Prl8a8 T C 13: 27,511,435 probably null Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptpro C A 6: 137,382,649 L406I probably benign Het
Rbpj T C 5: 53,600,934 S18P probably benign Het
Rhbg C T 3: 88,247,579 V173M probably damaging Het
Rps6kc1 A G 1: 190,800,057 S583P probably benign Het
Ryr1 T C 7: 29,095,205 S1217G probably benign Het
S1pr1 A T 3: 115,712,273 I224N probably damaging Het
Sall1 C T 8: 89,031,053 D808N probably benign Het
Ssh2 A T 11: 77,437,716 E369D probably benign Het
Stx1b C T 7: 127,807,359 V273M possibly damaging Het
Syne2 A G 12: 75,965,880 H2615R probably benign Het
Tmc8 T C 11: 117,784,932 I225T probably benign Het
Tmem126b A G 7: 90,472,646 I52T probably benign Het
Top2b G A 14: 16,416,605 D1122N probably benign Het
Trav13-2 T A 14: 53,634,906 S7T possibly damaging Het
Ttc1 A T 11: 43,745,362 L18Q probably damaging Het
Ttn A T 2: 76,737,209 I27780N probably damaging Het
Ubfd1 T C 7: 122,067,412 S44P probably benign Het
Vmn1r89 A G 7: 13,219,705 K123E probably damaging Het
Vmn2r62 A C 7: 42,787,892 F389L possibly damaging Het
Zdhhc11 T A 13: 73,973,607 M79K possibly damaging Het
Zfp202 G T 9: 40,207,344 V18F possibly damaging Het
Zfp39 A G 11: 58,891,043 F298L possibly damaging Het
Znrf1 G A 8: 111,537,439 G100D probably damaging Het
Other mutations in Shoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02498:Shoc2 APN 19 54027776 nonsense probably null
IGL02660:Shoc2 APN 19 53988021 missense probably benign
IGL02880:Shoc2 APN 19 54031094 missense probably benign 0.13
IGL03024:Shoc2 APN 19 54003027 missense probably benign
R1480:Shoc2 UTSW 19 53987771 missense probably benign 0.09
R4400:Shoc2 UTSW 19 54031229 missense probably benign 0.02
R4468:Shoc2 UTSW 19 54026414 missense probably damaging 0.98
R4765:Shoc2 UTSW 19 53988303 missense probably benign 0.00
R5309:Shoc2 UTSW 19 53987733 missense probably benign
R5408:Shoc2 UTSW 19 53988125 missense probably benign
R5745:Shoc2 UTSW 19 54029892 missense probably benign 0.09
R5991:Shoc2 UTSW 19 54003049 missense probably damaging 1.00
R6891:Shoc2 UTSW 19 53988117 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAGGAGGCTTTGGGAAAG -3'
(R):5'- CAAGCATCCGCAGCTTCTTC -3'

Sequencing Primer
(F):5'- AGAAGGAGTCCAGCGCTGC -3'
(R):5'- CCGCAGCTTCTTCAAGTTATCAAGAG -3'
Posted On2019-10-17