Incidental Mutation 'R0633:Cdc42bpb'
ID58097
Institutional Source Beutler Lab
Gene Symbol Cdc42bpb
Ensembl Gene ENSMUSG00000021279
Gene NameCDC42 binding protein kinase beta
SynonymsDMPK-like
MMRRC Submission 038822-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R0633 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111292976-111377718 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111345555 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 108 (I108V)
Ref Sequence ENSEMBL: ENSMUSP00000152832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041965] [ENSMUST00000222196]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041965
AA Change: I82V

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042565
Gene: ENSMUSG00000021279
AA Change: I82V

DomainStartEndE-ValueType
S_TKc 76 342 1e-87 SMART
S_TK_X 343 405 5.02e-10 SMART
Pfam:KELK 527 606 4.5e-32 PFAM
low complexity region 628 640 N/A INTRINSIC
coiled coil region 727 815 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Pfam:DMPK_coil 878 939 1.2e-29 PFAM
C1 1027 1076 1.43e-11 SMART
PH 1097 1217 1.19e-6 SMART
CNH 1240 1521 1.32e-10 SMART
low complexity region 1564 1576 N/A INTRINSIC
PBD 1585 1620 7.16e-10 SMART
low complexity region 1681 1696 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222196
AA Change: I108V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein contains a Cdc42/Rac-binding p21 binding domain resembling that of PAK kinase. The kinase domain of this protein is most closely related to that of myotonic dystrophy kinase-related ROK. Studies of the similar gene in rat suggested that this kinase may act as a downstream effector of Cdc42 in cytoskeletal reorganization. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,325,701 I82L probably benign Het
4921530L21Rik T G 14: 95,881,943 N45K probably damaging Het
4933408B17Rik A G 18: 34,586,266 V167A possibly damaging Het
Adamts8 A T 9: 30,943,511 R18S probably damaging Het
Adgb G A 10: 10,391,729 A923V probably benign Het
Aldh1a3 A G 7: 66,400,222 V416A probably damaging Het
Alox5 C T 6: 116,420,384 G280R probably damaging Het
Anapc5 A T 5: 122,800,632 Y360N probably damaging Het
Apbb1 C T 7: 105,558,963 V685I probably damaging Het
Apc2 C A 10: 80,307,455 A463E probably damaging Het
Arhgap21 C T 2: 20,855,387 W1170* probably null Het
Atat1 G A 17: 35,901,423 R305C probably damaging Het
Cars2 T C 8: 11,550,511 D56G probably benign Het
Cftr T A 6: 18,305,980 I1255K probably damaging Het
Ckap5 T C 2: 91,550,743 L148P probably damaging Het
Cntn4 A G 6: 106,679,248 probably null Het
Cpe G A 8: 64,609,203 P273L probably damaging Het
Cpsf7 A G 19: 10,531,782 D19G probably benign Het
Ddx25 C A 9: 35,545,972 R349L probably damaging Het
Depdc7 T C 2: 104,722,881 D446G probably benign Het
Det1 T A 7: 78,843,935 N107I probably benign Het
Dock6 A T 9: 21,844,417 D170E probably benign Het
Dvl1 C T 4: 155,858,295 L673F probably damaging Het
Gucy1b1 A T 3: 82,045,460 I222K probably benign Het
Hfm1 T C 5: 106,917,601 T71A possibly damaging Het
Ikzf1 A G 11: 11,769,223 E310G probably damaging Het
Impg1 T C 9: 80,394,155 E163G possibly damaging Het
Itpr2 G T 6: 146,374,456 H426Q probably damaging Het
Itpripl2 C T 7: 118,490,256 G360D probably benign Het
Kif14 C T 1: 136,527,305 R1572C probably damaging Het
L3mbtl3 A T 10: 26,302,685 H568Q unknown Het
Lgi2 A G 5: 52,554,460 Y173H probably damaging Het
Lpar5 A C 6: 125,081,991 Y225S probably benign Het
Lpin3 A G 2: 160,903,974 H675R probably damaging Het
Lrp2 C A 2: 69,448,120 G3963V probably damaging Het
Man1a2 G T 3: 100,684,575 D13E possibly damaging Het
Map1a T C 2: 121,308,014 V2753A probably damaging Het
Mitf C A 6: 98,003,904 N97K probably damaging Het
Msh2 A G 17: 87,672,810 probably null Het
Msr1 T C 8: 39,620,000 E170G probably damaging Het
Myrip C A 9: 120,388,236 R79S probably damaging Het
Nek10 G A 14: 14,857,782 probably null Het
Neto1 C T 18: 86,404,729 R104* probably null Het
Nom1 A C 5: 29,451,100 K821T probably damaging Het
Nrxn1 A G 17: 90,704,181 V340A probably damaging Het
Nxpe4 A T 9: 48,396,597 I334F probably benign Het
Olfr1043 T A 2: 86,162,091 N286I probably damaging Het
Olfr1065 C T 2: 86,445,129 M284I probably benign Het
Olfr1247 T C 2: 89,609,374 M243V probably benign Het
Olfr1489 T C 19: 13,633,336 V75A probably damaging Het
Olfr382 A G 11: 73,516,927 S91P probably benign Het
Olfr705 T C 7: 106,713,977 K235E probably benign Het
Padi4 A G 4: 140,757,585 S322P probably damaging Het
Peli3 A G 19: 4,941,782 Y44H probably damaging Het
Prdm4 A G 10: 85,907,903 S163P probably damaging Het
Prom2 T C 2: 127,539,525 D227G probably benign Het
Ptgfr C T 3: 151,801,763 R321H probably benign Het
Rgs3 G A 4: 62,625,906 R136H probably damaging Het
Rgsl1 T G 1: 153,844,107 N3T possibly damaging Het
Rif1 T C 2: 52,112,563 S2010P probably benign Het
Rngtt T C 4: 33,368,690 F408L probably damaging Het
Rtn3 T G 19: 7,457,593 T326P probably benign Het
Slc18b1 A C 10: 23,806,038 M167L probably benign Het
Slc22a26 A G 19: 7,788,210 probably null Het
Slitrk6 T C 14: 110,751,885 D130G probably damaging Het
Snap47 A G 11: 59,428,613 V233A probably benign Het
Sumf1 A C 6: 108,144,671 Y158D probably damaging Het
Tbc1d15 A T 10: 115,220,310 H252Q probably benign Het
Thsd7b T C 1: 130,188,526 S1339P possibly damaging Het
Tmem45a2 T C 16: 57,049,414 I56V probably benign Het
Ttc21b A G 2: 66,236,233 S359P probably benign Het
Ttc27 T C 17: 74,729,977 I215T probably benign Het
Ttn C T 2: 76,724,195 V30759I possibly damaging Het
Vdac3 T C 8: 22,580,388 N168S probably damaging Het
Wdr7 T C 18: 63,865,300 V1106A probably benign Het
Wrap73 T A 4: 154,142,491 F16Y probably damaging Het
Zfat C A 15: 68,180,803 D381Y probably damaging Het
Other mutations in Cdc42bpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Cdc42bpb APN 12 111294096 unclassified probably benign
IGL01360:Cdc42bpb APN 12 111342075 missense probably damaging 1.00
IGL01577:Cdc42bpb APN 12 111302043 missense possibly damaging 0.71
IGL01909:Cdc42bpb APN 12 111323142 missense probably benign
IGL01924:Cdc42bpb APN 12 111317453 unclassified probably benign
IGL02428:Cdc42bpb APN 12 111323127 missense probably benign
IGL02678:Cdc42bpb APN 12 111326096 missense probably damaging 1.00
IGL02792:Cdc42bpb APN 12 111299561 missense probably benign
IGL03367:Cdc42bpb APN 12 111336159 missense probably damaging 1.00
F5770:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
PIT4585001:Cdc42bpb UTSW 12 111304978 missense probably damaging 1.00
R0129:Cdc42bpb UTSW 12 111304959 intron probably benign
R1054:Cdc42bpb UTSW 12 111313353 missense probably benign 0.00
R1335:Cdc42bpb UTSW 12 111296441 missense probably damaging 1.00
R1459:Cdc42bpb UTSW 12 111296300 unclassified probably benign
R1780:Cdc42bpb UTSW 12 111322907 missense probably damaging 1.00
R1823:Cdc42bpb UTSW 12 111327559 missense probably damaging 1.00
R1843:Cdc42bpb UTSW 12 111322821 missense probably benign
R1902:Cdc42bpb UTSW 12 111326016 missense probably damaging 1.00
R1945:Cdc42bpb UTSW 12 111299133 missense probably damaging 1.00
R2077:Cdc42bpb UTSW 12 111299196 missense probably damaging 1.00
R2184:Cdc42bpb UTSW 12 111296044 missense probably damaging 0.99
R2208:Cdc42bpb UTSW 12 111336029 missense probably damaging 1.00
R2211:Cdc42bpb UTSW 12 111301854 missense probably benign 0.11
R2273:Cdc42bpb UTSW 12 111302167 missense probably damaging 1.00
R2406:Cdc42bpb UTSW 12 111302124 missense probably benign 0.00
R3080:Cdc42bpb UTSW 12 111295818 missense probably damaging 0.99
R3612:Cdc42bpb UTSW 12 111303822 intron probably benign
R4106:Cdc42bpb UTSW 12 111295145 missense probably benign 0.01
R4133:Cdc42bpb UTSW 12 111321542 missense probably benign 0.00
R4156:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4202:Cdc42bpb UTSW 12 111294139 missense probably benign 0.17
R4573:Cdc42bpb UTSW 12 111323141 missense probably benign 0.00
R4659:Cdc42bpb UTSW 12 111339891 missense probably damaging 1.00
R5101:Cdc42bpb UTSW 12 111299115 missense probably damaging 1.00
R5591:Cdc42bpb UTSW 12 111323087 missense probably benign 0.01
R5669:Cdc42bpb UTSW 12 111302013 critical splice donor site probably null
R5830:Cdc42bpb UTSW 12 111345582 nonsense probably null
R5872:Cdc42bpb UTSW 12 111325976 missense probably damaging 1.00
R6748:Cdc42bpb UTSW 12 111294839 unclassified probably benign
R6813:Cdc42bpb UTSW 12 111327615 missense probably damaging 1.00
R7024:Cdc42bpb UTSW 12 111326085 missense probably damaging 1.00
R7165:Cdc42bpb UTSW 12 111321517 missense probably damaging 1.00
R7228:Cdc42bpb UTSW 12 111305093 missense possibly damaging 0.92
R7258:Cdc42bpb UTSW 12 111326084 missense probably damaging 1.00
R7352:Cdc42bpb UTSW 12 111299311 missense probably damaging 1.00
R7361:Cdc42bpb UTSW 12 111345605 missense probably damaging 1.00
R7399:Cdc42bpb UTSW 12 111305667 missense probably benign 0.00
R7468:Cdc42bpb UTSW 12 111339873 missense probably damaging 1.00
R7622:Cdc42bpb UTSW 12 111294772 missense unknown
R7648:Cdc42bpb UTSW 12 111377153 missense probably damaging 1.00
R7734:Cdc42bpb UTSW 12 111329230 missense probably damaging 1.00
R7783:Cdc42bpb UTSW 12 111336025 critical splice donor site probably null
R8738:Cdc42bpb UTSW 12 111307787 missense probably benign 0.42
V7582:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
V7583:Cdc42bpb UTSW 12 111296391 missense probably benign 0.28
X0023:Cdc42bpb UTSW 12 111326078 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATACAAGAGCAAGCTCCATACCCTG -3'
(R):5'- ACAGCCATCCGTATTCAGAGAAAGC -3'

Sequencing Primer
(F):5'- gaggtggagagtgacagaag -3'
(R):5'- TATTCAGAGAAAGCTGCTAGTGTG -3'
Posted On2013-07-11