Incidental Mutation 'R7494:BC005561'
ID580977
Institutional Source Beutler Lab
Gene Symbol BC005561
Ensembl Gene ENSMUSG00000079065
Gene NamecDNA sequence BC005561
Synonyms
Accession Numbers

Genbank: NM_001166581; MGI: 3040669

Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R7494 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location104508352-104522611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104518418 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 269 (Y269H)
Ref Sequence ENSEMBL: ENSMUSP00000130629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096452
AA Change: Y269H

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130629
Gene: ENSMUSG00000079065
AA Change: Y269H

DomainStartEndE-ValueType
Pfam:THOC2_N 10 424 3.5e-65 PFAM
Pfam:THOC2_N 415 566 5.8e-32 PFAM
Pfam:Thoc2 568 643 8.3e-40 PFAM
low complexity region 729 747 N/A INTRINSIC
Pfam:Tho2 873 1173 1.1e-105 PFAM
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1266 1283 N/A INTRINSIC
coiled coil region 1310 1335 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
low complexity region 1459 1482 N/A INTRINSIC
low complexity region 1524 1543 N/A INTRINSIC
low complexity region 1561 1569 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G A 11: 110,208,745 T992I possibly damaging Het
Adamts10 T A 17: 33,549,378 C841* probably null Het
AI661453 C T 17: 47,468,180 P944S unknown Het
Als2 G A 1: 59,183,166 probably null Het
Anapc2 A G 2: 25,276,364 E381G possibly damaging Het
Ank3 T C 10: 69,988,926 Y1142H Het
Apip A T 2: 103,092,551 N238I probably benign Het
Cblc A T 7: 19,792,812 V165D possibly damaging Het
Cep295nl T A 11: 118,333,932 M29L probably benign Het
Clec12a A G 6: 129,353,399 I47V possibly damaging Het
Dpp9 T C 17: 56,200,619 Y350C probably damaging Het
Enpp2 C T 15: 54,910,158 G56R probably damaging Het
Epsti1 G T 14: 77,928,754 E82D probably benign Het
Eri2 C A 7: 119,786,081 C399F probably damaging Het
Ern1 T C 11: 106,407,535 T672A probably damaging Het
Fbxo21 T A 5: 118,000,323 C445S possibly damaging Het
Folh1 G T 7: 86,719,699 T740K probably damaging Het
Gapt A G 13: 110,353,728 Y134H probably damaging Het
Gm19410 T C 8: 35,795,530 S874P probably damaging Het
Gm2431 G A 7: 142,257,810 P119L unknown Het
Gzmc G A 14: 56,232,328 Q172* probably null Het
Hoxa1 C A 6: 52,157,591 V211F probably damaging Het
Hyou1 G T 9: 44,389,409 R925L probably benign Het
Ilvbl A G 10: 78,579,023 Y240C possibly damaging Het
Lama1 T A 17: 67,811,446 F2551Y Het
Lrrtm3 A G 10: 64,089,179 Y70H probably damaging Het
Naa38 T A 11: 69,396,300 C69S probably damaging Het
Olfr1061 A T 2: 86,413,248 I268N probably benign Het
Olfr1126 T A 2: 87,457,568 N134K probably damaging Het
Olfr325 T C 11: 58,581,212 S123P probably damaging Het
Panx3 A G 9: 37,661,312 L314P probably damaging Het
Polr2f T C 15: 79,144,665 probably null Het
Prkcd C A 14: 30,609,193 R75L probably benign Het
Psap A C 10: 60,299,496 L313F probably benign Het
Psen1 T A 12: 83,728,243 C263S probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Pura T A 18: 36,287,889 M243K probably damaging Het
Sec16b T C 1: 157,560,799 S579P probably benign Het
Sept1 T A 7: 127,214,950 E338V probably damaging Het
Sgms1 A G 19: 32,129,691 F255L probably benign Het
Slc4a2 A G 5: 24,432,864 T353A possibly damaging Het
Smg6 T C 11: 74,929,623 V240A probably benign Het
Sntg2 T G 12: 30,229,634 D340A possibly damaging Het
Sun1 C T 5: 139,235,720 P553S probably benign Het
Tas2r137 T C 6: 40,491,320 V28A probably damaging Het
Tfcp2l1 T C 1: 118,664,956 F323S probably damaging Het
Tpcn2 G A 7: 145,278,849 T90I possibly damaging Het
Ttc30a1 A C 2: 75,979,898 F614V probably damaging Het
Ttn A T 2: 76,889,977 Y6968* probably null Het
Vmn2r44 A T 7: 8,383,123 L39* probably null Het
Other mutations in BC005561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:BC005561 APN 5 104520500 missense probably damaging 1.00
IGL01024:BC005561 APN 5 104521746 missense probably benign 0.02
IGL01133:BC005561 APN 5 104517662 missense probably benign
IGL01564:BC005561 APN 5 104520663 missense probably benign 0.12
IGL01727:BC005561 APN 5 104519513 missense probably benign 0.01
IGL02086:BC005561 APN 5 104519001 missense possibly damaging 0.49
IGL02153:BC005561 APN 5 104521083 missense probably benign 0.02
IGL02256:BC005561 APN 5 104520283 nonsense probably null
IGL02436:BC005561 APN 5 104521155 missense probably benign 0.10
IGL02969:BC005561 APN 5 104519343 missense probably benign 0.01
IGL03275:BC005561 APN 5 104518277 missense probably benign 0.00
IGL03357:BC005561 APN 5 104520468 missense probably damaging 1.00
F2404:BC005561 UTSW 5 104520230 missense possibly damaging 0.83
R0318:BC005561 UTSW 5 104517753 missense probably benign 0.00
R0349:BC005561 UTSW 5 104519976 missense possibly damaging 0.85
R0454:BC005561 UTSW 5 104518211 missense probably benign 0.45
R0742:BC005561 UTSW 5 104522154 missense probably benign 0.00
R0842:BC005561 UTSW 5 104519200 missense possibly damaging 0.81
R0882:BC005561 UTSW 5 104519009 missense probably benign 0.05
R1123:BC005561 UTSW 5 104518470 missense probably damaging 1.00
R1171:BC005561 UTSW 5 104520903 missense possibly damaging 0.49
R1205:BC005561 UTSW 5 104520213 missense probably benign 0.28
R1261:BC005561 UTSW 5 104520635 missense probably damaging 0.98
R1432:BC005561 UTSW 5 104518104 missense probably damaging 1.00
R1447:BC005561 UTSW 5 104522204 missense possibly damaging 0.89
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1466:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1584:BC005561 UTSW 5 104518257 missense probably damaging 0.99
R1636:BC005561 UTSW 5 104520750 missense probably damaging 0.99
R1686:BC005561 UTSW 5 104519923 nonsense probably null
R1698:BC005561 UTSW 5 104520510 missense probably benign 0.09
R1816:BC005561 UTSW 5 104517834 missense probably benign 0.16
R1903:BC005561 UTSW 5 104518330 missense probably benign 0.00
R2096:BC005561 UTSW 5 104519969 missense possibly damaging 0.95
R2146:BC005561 UTSW 5 104518991 missense probably benign
R2226:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2227:BC005561 UTSW 5 104519420 missense probably damaging 1.00
R2383:BC005561 UTSW 5 104518988 missense probably benign 0.23
R2656:BC005561 UTSW 5 104519315 missense probably benign 0.05
R3982:BC005561 UTSW 5 104521023 missense probably benign 0.29
R3983:BC005561 UTSW 5 104521023 missense probably benign 0.29
R4115:BC005561 UTSW 5 104519433 missense probably damaging 1.00
R4345:BC005561 UTSW 5 104521449 missense probably benign 0.21
R4697:BC005561 UTSW 5 104522240 missense probably benign 0.00
R4711:BC005561 UTSW 5 104519661 missense probably damaging 0.98
R4742:BC005561 UTSW 5 104518857 missense probably benign 0.17
R4758:BC005561 UTSW 5 104520399 missense possibly damaging 0.48
R4863:BC005561 UTSW 5 104517750 missense possibly damaging 0.89
R4867:BC005561 UTSW 5 104521002 missense possibly damaging 0.91
R5024:BC005561 UTSW 5 104522258 missense possibly damaging 0.68
R5114:BC005561 UTSW 5 104519876 missense probably damaging 0.99
R5117:BC005561 UTSW 5 104520255 missense probably damaging 1.00
R5289:BC005561 UTSW 5 104519657 missense probably benign 0.03
R5341:BC005561 UTSW 5 104518076 missense probably damaging 1.00
R5420:BC005561 UTSW 5 104518359 missense probably damaging 0.99
R5421:BC005561 UTSW 5 104518395 missense probably benign 0.01
R5422:BC005561 UTSW 5 104519646 missense probably damaging 0.98
R5606:BC005561 UTSW 5 104521878 missense probably benign 0.00
R5939:BC005561 UTSW 5 104519207 missense possibly damaging 0.56
R6104:BC005561 UTSW 5 104518218 missense probably damaging 1.00
R6169:BC005561 UTSW 5 104518396 missense probably benign 0.00
R6316:BC005561 UTSW 5 104519729 missense probably damaging 1.00
R6352:BC005561 UTSW 5 104520198 missense probably benign 0.11
R6408:BC005561 UTSW 5 104518777 missense probably benign 0.19
R6458:BC005561 UTSW 5 104522303 missense probably benign 0.02
R6722:BC005561 UTSW 5 104520279 missense probably damaging 0.99
R6789:BC005561 UTSW 5 104517689 missense probably benign 0.00
R7214:BC005561 UTSW 5 104522363 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGTGCTTTAATCTAGATCCC -3'
(R):5'- GGTTGTCAGGTGCCTTCTCTAC -3'

Sequencing Primer
(F):5'- GGGTGCTTTAATCTAGATCCCAATAG -3'
(R):5'- GTCAGGTGCCTTCTCTACCTTATC -3'
Posted On2019-10-17