Mutagenetix > Incidental Mutations

Incidental Mutation 'R7494:Cblc'

580984

Institutional Source

Beutler Lab

Gene Symbol

Cblc

Ensembl Gene

ENSMUSG00000040525

Gene Name

Casitas B-lineage lymphoma c

Synonyms

2310076I21Rik, Cbl3, 2310079L19Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7494 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

19778881-19796809 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19792812 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 165 (V165D)

Ref Sequence

ENSEMBL: ENSMUSP00000039955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043822
AA Change: V165D

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: V165D

Domain	Start	End	E-Value	Type
Pfam:Cbl_N	13	144	2.6e-44	PFAM
Pfam:Cbl_N2	148	231	1.8e-35	PFAM
SH2	234	347	4.35e0	SMART
RING	350	388	1.92e-6	SMART
low complexity region	458	473	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108449
AA Change: V165D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: V165D

Domain	Start	End	E-Value	Type
Pfam:Cbl_N	11	145	7.1e-20	PFAM
Pfam:Cbl_N2	147	231	2.3e-48	PFAM
SH2	234	333	5.28e0	SMART
low complexity region	414	429	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	G	A	11: 110,208,745	T992I	possibly damaging	Het
Adamts10	T	A	17: 33,549,378	C841*	probably null	Het
AI661453	C	T	17: 47,468,180	P944S	unknown	Het
Als2	G	A	1: 59,183,166		probably null	Het
Anapc2	A	G	2: 25,276,364	E381G	possibly damaging	Het
Ank3	T	C	10: 69,988,926	Y1142H		Het
Apip	A	T	2: 103,092,551	N238I	probably benign	Het
BC005561	T	C	5: 104,518,418	Y269H	possibly damaging	Het
Cep295nl	T	A	11: 118,333,932	M29L	probably benign	Het
Clec12a	A	G	6: 129,353,399	I47V	possibly damaging	Het
Dpp9	T	C	17: 56,200,619	Y350C	probably damaging	Het
Enpp2	C	T	15: 54,910,158	G56R	probably damaging	Het
Epsti1	G	T	14: 77,928,754	E82D	probably benign	Het
Eri2	C	A	7: 119,786,081	C399F	probably damaging	Het
Ern1	T	C	11: 106,407,535	T672A	probably damaging	Het
Fbxo21	T	A	5: 118,000,323	C445S	possibly damaging	Het
Folh1	G	T	7: 86,719,699	T740K	probably damaging	Het
Gapt	A	G	13: 110,353,728	Y134H	probably damaging	Het
Gm19410	T	C	8: 35,795,530	S874P	probably damaging	Het
Gm2431	G	A	7: 142,257,810	P119L	unknown	Het
Gzmc	G	A	14: 56,232,328	Q172*	probably null	Het
Hoxa1	C	A	6: 52,157,591	V211F	probably damaging	Het
Hyou1	G	T	9: 44,389,409	R925L	probably benign	Het
Ilvbl	A	G	10: 78,579,023	Y240C	possibly damaging	Het
Lama1	T	A	17: 67,811,446	F2551Y		Het
Lrrtm3	A	G	10: 64,089,179	Y70H	probably damaging	Het
Naa38	T	A	11: 69,396,300	C69S	probably damaging	Het
Olfr1061	A	T	2: 86,413,248	I268N	probably benign	Het
Olfr1126	T	A	2: 87,457,568	N134K	probably damaging	Het
Olfr325	T	C	11: 58,581,212	S123P	probably damaging	Het
Panx3	A	G	9: 37,661,312	L314P	probably damaging	Het
Polr2f	T	C	15: 79,144,665		probably null	Het
Prkcd	C	A	14: 30,609,193	R75L	probably benign	Het
Psap	A	C	10: 60,299,496	L313F	probably benign	Het
Psen1	T	A	12: 83,728,243	C263S	probably benign	Het
Ptma	GGAAGAAG	GGAAGAAGAAG	1: 86,529,539		probably benign	Het
Pura	T	A	18: 36,287,889	M243K	probably damaging	Het
Sec16b	T	C	1: 157,560,799	S579P	probably benign	Het
Sept1	T	A	7: 127,214,950	E338V	probably damaging	Het
Sgms1	A	G	19: 32,129,691	F255L	probably benign	Het
Slc4a2	A	G	5: 24,432,864	T353A	possibly damaging	Het
Smg6	T	C	11: 74,929,623	V240A	probably benign	Het
Sntg2	T	G	12: 30,229,634	D340A	possibly damaging	Het
Sun1	C	T	5: 139,235,720	P553S	probably benign	Het
Tas2r137	T	C	6: 40,491,320	V28A	probably damaging	Het
Tfcp2l1	T	C	1: 118,664,956	F323S	probably damaging	Het
Tpcn2	G	A	7: 145,278,849	T90I	possibly damaging	Het
Ttc30a1	A	C	2: 75,979,898	F614V	probably damaging	Het
Ttn	A	T	2: 76,889,977	Y6968*	probably null	Het
Vmn2r44	A	T	7: 8,383,123	L39*	probably null	Het

Other mutations in Cblc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01510:Cblc	APN	7	19785275	missense	probably benign	0.00
R0583:Cblc	UTSW	7	19792561	missense	probably benign	0.41
R0847:Cblc	UTSW	7	19790534	nonsense	probably null
R1594:Cblc	UTSW	7	19792546	missense	probably damaging	1.00
R1626:Cblc	UTSW	7	19796502	missense	probably damaging	1.00
R1719:Cblc	UTSW	7	19790474	missense	probably benign	0.00
R1894:Cblc	UTSW	7	19792577	missense	probably damaging	0.99
R2011:Cblc	UTSW	7	19784822	missense	probably benign	0.01
R2395:Cblc	UTSW	7	19785380	missense	probably damaging	1.00
R2852:Cblc	UTSW	7	19780964	splice site	probably null
R3832:Cblc	UTSW	7	19792172	missense	probably damaging	0.98
R4696:Cblc	UTSW	7	19796482	missense	probably damaging	1.00
R5159:Cblc	UTSW	7	19785308	missense	probably benign	0.01
R5328:Cblc	UTSW	7	19792580	missense	possibly damaging	0.68
R5487:Cblc	UTSW	7	19784808	missense	probably benign	0.06
R5659:Cblc	UTSW	7	19792932	missense	probably damaging	1.00
R6209:Cblc	UTSW	7	19785305	missense	possibly damaging	0.47
R6519:Cblc	UTSW	7	19792863	missense	probably damaging	1.00
R6841:Cblc	UTSW	7	19792896	missense	probably damaging	1.00
R7371:Cblc	UTSW	7	19792903	missense	probably benign	0.00
R7417:Cblc	UTSW	7	19788974	missense	probably benign	0.41
X0028:Cblc	UTSW	7	19785273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTACAGGTGAGGTCCAAGGTG -3'
(R):5'- GTGTGATGCTCATAGCTTCCCC -3'

Sequencing Primer
(F):5'- TCCAAGGTGGACCGCAAG -3'
(R):5'- CTCATCTTCAGTCACATGC -3'

Posted On

2019-10-17