Incidental Mutation 'R7494:Cblc'
ID580984
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7494 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19792812 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 165 (V165D)
Ref Sequence ENSEMBL: ENSMUSP00000039955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043822
AA Change: V165D

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: V165D

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108449
AA Change: V165D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: V165D

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G A 11: 110,208,745 T992I possibly damaging Het
Adamts10 T A 17: 33,549,378 C841* probably null Het
AI661453 C T 17: 47,468,180 P944S unknown Het
Als2 G A 1: 59,183,166 probably null Het
Anapc2 A G 2: 25,276,364 E381G possibly damaging Het
Ank3 T C 10: 69,988,926 Y1142H Het
Apip A T 2: 103,092,551 N238I probably benign Het
BC005561 T C 5: 104,518,418 Y269H possibly damaging Het
Cep295nl T A 11: 118,333,932 M29L probably benign Het
Clec12a A G 6: 129,353,399 I47V possibly damaging Het
Dpp9 T C 17: 56,200,619 Y350C probably damaging Het
Enpp2 C T 15: 54,910,158 G56R probably damaging Het
Epsti1 G T 14: 77,928,754 E82D probably benign Het
Eri2 C A 7: 119,786,081 C399F probably damaging Het
Ern1 T C 11: 106,407,535 T672A probably damaging Het
Fbxo21 T A 5: 118,000,323 C445S possibly damaging Het
Folh1 G T 7: 86,719,699 T740K probably damaging Het
Gapt A G 13: 110,353,728 Y134H probably damaging Het
Gm19410 T C 8: 35,795,530 S874P probably damaging Het
Gm2431 G A 7: 142,257,810 P119L unknown Het
Gzmc G A 14: 56,232,328 Q172* probably null Het
Hoxa1 C A 6: 52,157,591 V211F probably damaging Het
Hyou1 G T 9: 44,389,409 R925L probably benign Het
Ilvbl A G 10: 78,579,023 Y240C possibly damaging Het
Lama1 T A 17: 67,811,446 F2551Y Het
Lrrtm3 A G 10: 64,089,179 Y70H probably damaging Het
Naa38 T A 11: 69,396,300 C69S probably damaging Het
Olfr1061 A T 2: 86,413,248 I268N probably benign Het
Olfr1126 T A 2: 87,457,568 N134K probably damaging Het
Olfr325 T C 11: 58,581,212 S123P probably damaging Het
Panx3 A G 9: 37,661,312 L314P probably damaging Het
Polr2f T C 15: 79,144,665 probably null Het
Prkcd C A 14: 30,609,193 R75L probably benign Het
Psap A C 10: 60,299,496 L313F probably benign Het
Psen1 T A 12: 83,728,243 C263S probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Pura T A 18: 36,287,889 M243K probably damaging Het
Sec16b T C 1: 157,560,799 S579P probably benign Het
Sept1 T A 7: 127,214,950 E338V probably damaging Het
Sgms1 A G 19: 32,129,691 F255L probably benign Het
Slc4a2 A G 5: 24,432,864 T353A possibly damaging Het
Smg6 T C 11: 74,929,623 V240A probably benign Het
Sntg2 T G 12: 30,229,634 D340A possibly damaging Het
Sun1 C T 5: 139,235,720 P553S probably benign Het
Tas2r137 T C 6: 40,491,320 V28A probably damaging Het
Tfcp2l1 T C 1: 118,664,956 F323S probably damaging Het
Tpcn2 G A 7: 145,278,849 T90I possibly damaging Het
Ttc30a1 A C 2: 75,979,898 F614V probably damaging Het
Ttn A T 2: 76,889,977 Y6968* probably null Het
Vmn2r44 A T 7: 8,383,123 L39* probably null Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1626:Cblc UTSW 7 19796502 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R2852:Cblc UTSW 7 19780964 splice site probably null
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R4696:Cblc UTSW 7 19796482 missense probably damaging 1.00
R5159:Cblc UTSW 7 19785308 missense probably benign 0.01
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R5659:Cblc UTSW 7 19792932 missense probably damaging 1.00
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R6841:Cblc UTSW 7 19792896 missense probably damaging 1.00
R7371:Cblc UTSW 7 19792903 missense probably benign 0.00
R7417:Cblc UTSW 7 19788974 missense probably benign 0.41
X0028:Cblc UTSW 7 19785273 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACAGGTGAGGTCCAAGGTG -3'
(R):5'- GTGTGATGCTCATAGCTTCCCC -3'

Sequencing Primer
(F):5'- TCCAAGGTGGACCGCAAG -3'
(R):5'- CTCATCTTCAGTCACATGC -3'
Posted On2019-10-17