Incidental Mutation 'R7494:Panx3'
ID580991
Institutional Source Beutler Lab
Gene Symbol Panx3
Ensembl Gene ENSMUSG00000011118
Gene Namepannexin 3
Synonyms4833413G11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7494 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37659902-37669235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37661312 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 314 (L314P)
Ref Sequence ENSEMBL: ENSMUSP00000011262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011262] [ENSMUST00000117654] [ENSMUST00000142228] [ENSMUST00000142736]
Predicted Effect probably damaging
Transcript: ENSMUST00000011262
AA Change: L314P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000011262
Gene: ENSMUSG00000011118
AA Change: L314P

DomainStartEndE-ValueType
Pfam:Innexin 33 270 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117654
SMART Domains Protein: ENSMUSP00000112600
Gene: ENSMUSG00000011114

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
coiled coil region 56 79 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 124 156 N/A INTRINSIC
FYRN 192 235 1.05e-18 SMART
Pfam:FYRC 238 316 1.4e-23 PFAM
low complexity region 349 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142228
Predicted Effect probably benign
Transcript: ENSMUST00000142736
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are known to be the structural components of gap junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against surgically induced osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G A 11: 110,208,745 T992I possibly damaging Het
Adamts10 T A 17: 33,549,378 C841* probably null Het
AI661453 C T 17: 47,468,180 P944S unknown Het
Als2 G A 1: 59,183,166 probably null Het
Anapc2 A G 2: 25,276,364 E381G possibly damaging Het
Ank3 T C 10: 69,988,926 Y1142H Het
Apip A T 2: 103,092,551 N238I probably benign Het
BC005561 T C 5: 104,518,418 Y269H possibly damaging Het
Cblc A T 7: 19,792,812 V165D possibly damaging Het
Cep295nl T A 11: 118,333,932 M29L probably benign Het
Clec12a A G 6: 129,353,399 I47V possibly damaging Het
Dpp9 T C 17: 56,200,619 Y350C probably damaging Het
Enpp2 C T 15: 54,910,158 G56R probably damaging Het
Epsti1 G T 14: 77,928,754 E82D probably benign Het
Eri2 C A 7: 119,786,081 C399F probably damaging Het
Ern1 T C 11: 106,407,535 T672A probably damaging Het
Fbxo21 T A 5: 118,000,323 C445S possibly damaging Het
Folh1 G T 7: 86,719,699 T740K probably damaging Het
Gapt A G 13: 110,353,728 Y134H probably damaging Het
Gm19410 T C 8: 35,795,530 S874P probably damaging Het
Gm2431 G A 7: 142,257,810 P119L unknown Het
Gzmc G A 14: 56,232,328 Q172* probably null Het
Hoxa1 C A 6: 52,157,591 V211F probably damaging Het
Hyou1 G T 9: 44,389,409 R925L probably benign Het
Ilvbl A G 10: 78,579,023 Y240C possibly damaging Het
Lama1 T A 17: 67,811,446 F2551Y Het
Lrrtm3 A G 10: 64,089,179 Y70H probably damaging Het
Naa38 T A 11: 69,396,300 C69S probably damaging Het
Olfr1061 A T 2: 86,413,248 I268N probably benign Het
Olfr1126 T A 2: 87,457,568 N134K probably damaging Het
Olfr325 T C 11: 58,581,212 S123P probably damaging Het
Polr2f T C 15: 79,144,665 probably null Het
Prkcd C A 14: 30,609,193 R75L probably benign Het
Psap A C 10: 60,299,496 L313F probably benign Het
Psen1 T A 12: 83,728,243 C263S probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Pura T A 18: 36,287,889 M243K probably damaging Het
Sec16b T C 1: 157,560,799 S579P probably benign Het
Sept1 T A 7: 127,214,950 E338V probably damaging Het
Sgms1 A G 19: 32,129,691 F255L probably benign Het
Slc4a2 A G 5: 24,432,864 T353A possibly damaging Het
Smg6 T C 11: 74,929,623 V240A probably benign Het
Sntg2 T G 12: 30,229,634 D340A possibly damaging Het
Sun1 C T 5: 139,235,720 P553S probably benign Het
Tas2r137 T C 6: 40,491,320 V28A probably damaging Het
Tfcp2l1 T C 1: 118,664,956 F323S probably damaging Het
Tpcn2 G A 7: 145,278,849 T90I possibly damaging Het
Ttc30a1 A C 2: 75,979,898 F614V probably damaging Het
Ttn A T 2: 76,889,977 Y6968* probably null Het
Vmn2r44 A T 7: 8,383,123 L39* probably null Het
Other mutations in Panx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Panx3 APN 9 37661471 missense probably damaging 1.00
IGL01371:Panx3 APN 9 37661475 missense probably benign 0.03
IGL01458:Panx3 APN 9 37661147 missense probably damaging 0.99
IGL01637:Panx3 APN 9 37664056 missense probably damaging 0.98
R1693:Panx3 UTSW 9 37668907 missense possibly damaging 0.64
R1693:Panx3 UTSW 9 37668946 missense possibly damaging 0.88
R1708:Panx3 UTSW 9 37661391 missense probably benign 0.00
R1818:Panx3 UTSW 9 37664026 missense probably benign 0.04
R2142:Panx3 UTSW 9 37666673 missense probably damaging 1.00
R5386:Panx3 UTSW 9 37669024 missense probably damaging 0.99
R5981:Panx3 UTSW 9 37668881 missense possibly damaging 0.93
R6273:Panx3 UTSW 9 37667429 missense probably benign 0.01
R6429:Panx3 UTSW 9 37661165 missense probably damaging 1.00
R6768:Panx3 UTSW 9 37664026 missense probably benign 0.04
R7082:Panx3 UTSW 9 37666617 missense probably benign 0.25
R7165:Panx3 UTSW 9 37664085 missense probably damaging 1.00
R7173:Panx3 UTSW 9 37661300 missense probably damaging 0.99
R7629:Panx3 UTSW 9 37661444 missense possibly damaging 0.83
R7650:Panx3 UTSW 9 37661405 missense probably damaging 0.97
R8032:Panx3 UTSW 9 37661670 missense probably damaging 1.00
R8383:Panx3 UTSW 9 37666753 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TTCTAAGCCAGCCACAAAGG -3'
(R):5'- CATCAAGACAGGGCTGCTAC -3'

Sequencing Primer
(F):5'- GGTCATAAAGTCAACCACTGTGTCG -3'
(R):5'- CTGCTACATGATGAGACCCATGTG -3'
Posted On2019-10-17