Incidental Mutation 'R7494:Ank3'
ID580995
Institutional Source Beutler Lab
Gene Symbol Ank3
Ensembl Gene ENSMUSG00000069601
Gene Nameankyrin 3, epithelial
SynonymsAnkyrin-3, Ankyrin-G, AnkG, Ank-3, 2900054D09Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.837) question?
Stock #R7494 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location69398773-70027438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69988926 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1142 (Y1142H)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047061] [ENSMUST00000054167] [ENSMUST00000092431] [ENSMUST00000092432] [ENSMUST00000092433] [ENSMUST00000092434] [ENSMUST00000181974] [ENSMUST00000182029] [ENSMUST00000182155] [ENSMUST00000182207] [ENSMUST00000182269] [ENSMUST00000182437] [ENSMUST00000182439] [ENSMUST00000182692] [ENSMUST00000182795] [ENSMUST00000182884] [ENSMUST00000182972] [ENSMUST00000182992] [ENSMUST00000183023] [ENSMUST00000183074] [ENSMUST00000183148] [ENSMUST00000183169] [ENSMUST00000183261] [ENSMUST00000185582] [ENSMUST00000218680]
Predicted Effect probably benign
Transcript: ENSMUST00000047061
SMART Domains Protein: ENSMUSP00000045834
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054167
SMART Domains Protein: ENSMUSP00000061698
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1760 1780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092431
SMART Domains Protein: ENSMUSP00000090087
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 885 902 N/A INTRINSIC
ZU5 962 1066 2.27e-58 SMART
DEATH 1447 1541 5.8e-33 SMART
low complexity region 1778 1798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092432
SMART Domains Protein: ENSMUSP00000090088
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 888 905 N/A INTRINSIC
ZU5 965 1069 2.27e-58 SMART
DEATH 1450 1544 5.8e-33 SMART
low complexity region 1781 1801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092433
SMART Domains Protein: ENSMUSP00000090089
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092434
SMART Domains Protein: ENSMUSP00000090090
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 6.5e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7.1e-9 SMART
ANK 155 183 4.2e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.4e-7 SMART
ANK 250 279 3.8e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.3e-7 SMART
ANK 349 378 9.9e-8 SMART
ANK 382 411 2.5e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 6e-8 SMART
ANK 481 510 7.4e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.2e-8 SMART
ANK 580 609 3e-6 SMART
ANK 613 642 5.4e-8 SMART
ANK 646 675 3.3e-6 SMART
ANK 679 708 4.3e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 9.1e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.8e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181974
SMART Domains Protein: ENSMUSP00000138285
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 736 756 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182029
SMART Domains Protein: ENSMUSP00000138337
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182155
SMART Domains Protein: ENSMUSP00000138347
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1564 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182207
SMART Domains Protein: ENSMUSP00000138531
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
DEATH 59 153 5.8e-33 SMART
low complexity region 297 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182269
SMART Domains Protein: ENSMUSP00000138123
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 886 895 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 935 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182437
SMART Domains Protein: ENSMUSP00000138586
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 869 878 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 918 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182439
SMART Domains Protein: ENSMUSP00000138356
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000182665
Predicted Effect probably benign
Transcript: ENSMUST00000182692
SMART Domains Protein: ENSMUSP00000138623
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 839 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182795
SMART Domains Protein: ENSMUSP00000138413
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 111 215 2.27e-58 SMART
DEATH 584 678 7.66e-33 SMART
low complexity region 719 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182884
SMART Domains Protein: ENSMUSP00000138326
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 6.4e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7e-9 SMART
ANK 155 183 4.1e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.2e-7 SMART
ANK 250 279 3.7e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.2e-7 SMART
ANK 349 378 9.7e-8 SMART
ANK 382 411 2.4e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 5.9e-8 SMART
ANK 481 510 7.3e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.1e-8 SMART
ANK 580 609 2.9e-6 SMART
ANK 613 642 5.3e-8 SMART
ANK 646 675 3.2e-6 SMART
ANK 679 708 4.2e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 8.9e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.7e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182972
SMART Domains Protein: ENSMUSP00000138481
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 4 33 1.43e-5 SMART
low complexity region 61 72 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
ZU5 203 307 2.27e-58 SMART
DEATH 688 782 5.8e-33 SMART
low complexity region 1019 1039 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182992
SMART Domains Protein: ENSMUSP00000138686
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
coiled coil region 4 38 N/A INTRINSIC
ANK 73 102 1.01e-5 SMART
ANK 106 135 1.66e-6 SMART
ANK 139 168 1.1e-6 SMART
ANK 172 200 6.51e0 SMART
ANK 201 230 2.6e1 SMART
ANK 242 271 1.31e-4 SMART
ANK 275 304 5.88e-7 SMART
ANK 308 337 3.23e-4 SMART
ANK 341 370 8.07e-5 SMART
ANK 374 403 1.53e-5 SMART
ANK 407 436 3.88e-7 SMART
ANK 440 469 1.99e-4 SMART
ANK 473 502 9.41e-6 SMART
ANK 506 535 1.14e-4 SMART
ANK 539 568 2.94e-7 SMART
ANK 572 601 3.33e-6 SMART
ANK 605 634 4.56e-4 SMART
ANK 638 667 8.19e-6 SMART
ANK 671 700 5.24e-4 SMART
ANK 704 733 6.46e-4 SMART
ANK 737 766 6.21e-6 SMART
ANK 770 799 1.43e-5 SMART
low complexity region 827 838 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
ZU5 990 1094 2.27e-58 SMART
low complexity region 1515 1536 N/A INTRINSIC
low complexity region 1745 1762 N/A INTRINSIC
low complexity region 1805 1827 N/A INTRINSIC
low complexity region 1876 1897 N/A INTRINSIC
low complexity region 1969 1984 N/A INTRINSIC
DEATH 2325 2419 7.66e-33 SMART
low complexity region 2460 2480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183023
SMART Domains Protein: ENSMUSP00000138450
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
DEATH 260 354 7.66e-33 SMART
low complexity region 395 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183074
SMART Domains Protein: ENSMUSP00000138671
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1065 1074 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1114 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183082
Predicted Effect probably benign
Transcript: ENSMUST00000183148
SMART Domains Protein: ENSMUSP00000138770
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1747 1767 N/A INTRINSIC
low complexity region 1893 1902 N/A INTRINSIC
low complexity region 1904 1916 N/A INTRINSIC
low complexity region 1942 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183169
SMART Domains Protein: ENSMUSP00000138348
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1551 1571 N/A INTRINSIC
low complexity region 1715 1724 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183261
SMART Domains Protein: ENSMUSP00000138095
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1082 1091 N/A INTRINSIC
low complexity region 1093 1105 N/A INTRINSIC
low complexity region 1131 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185582
SMART Domains Protein: ENSMUSP00000140724
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 66 94 N/A INTRINSIC
Pfam:Death 138 178 7.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218680
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ankyrin protein family. Ankyrins link integral membrane proteins to the spectrin-based cytoskeleton. Ankyrin family members share a protein structure which includes three independently folded domains: the N-terminal ankyrin repeat domain, the central spectrin-binding domain, and the C-terminal rod domain. This ankyrin functions as the major ankyrin in the kidney and may play a role in the polarized distribution of many integral membrane proteins to specific subcellular sites. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a mutation that selectively ablates gene expression in brain exhibit progressive ataxia, tremors, and a substantially reduced cerebellum deficient in Purkinje cells. Mutants are poor breeders and die by 4-6 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 G A 11: 110,208,745 T992I possibly damaging Het
Adamts10 T A 17: 33,549,378 C841* probably null Het
AI661453 C T 17: 47,468,180 P944S unknown Het
Als2 G A 1: 59,183,166 probably null Het
Anapc2 A G 2: 25,276,364 E381G possibly damaging Het
Apip A T 2: 103,092,551 N238I probably benign Het
BC005561 T C 5: 104,518,418 Y269H possibly damaging Het
Cblc A T 7: 19,792,812 V165D possibly damaging Het
Cep295nl T A 11: 118,333,932 M29L probably benign Het
Clec12a A G 6: 129,353,399 I47V possibly damaging Het
Dpp9 T C 17: 56,200,619 Y350C probably damaging Het
Enpp2 C T 15: 54,910,158 G56R probably damaging Het
Epsti1 G T 14: 77,928,754 E82D probably benign Het
Eri2 C A 7: 119,786,081 C399F probably damaging Het
Ern1 T C 11: 106,407,535 T672A probably damaging Het
Fbxo21 T A 5: 118,000,323 C445S possibly damaging Het
Folh1 G T 7: 86,719,699 T740K probably damaging Het
Gapt A G 13: 110,353,728 Y134H probably damaging Het
Gm19410 T C 8: 35,795,530 S874P probably damaging Het
Gm2431 G A 7: 142,257,810 P119L unknown Het
Gzmc G A 14: 56,232,328 Q172* probably null Het
Hoxa1 C A 6: 52,157,591 V211F probably damaging Het
Hyou1 G T 9: 44,389,409 R925L probably benign Het
Ilvbl A G 10: 78,579,023 Y240C possibly damaging Het
Lama1 T A 17: 67,811,446 F2551Y Het
Lrrtm3 A G 10: 64,089,179 Y70H probably damaging Het
Naa38 T A 11: 69,396,300 C69S probably damaging Het
Olfr1061 A T 2: 86,413,248 I268N probably benign Het
Olfr1126 T A 2: 87,457,568 N134K probably damaging Het
Olfr325 T C 11: 58,581,212 S123P probably damaging Het
Panx3 A G 9: 37,661,312 L314P probably damaging Het
Polr2f T C 15: 79,144,665 probably null Het
Prkcd C A 14: 30,609,193 R75L probably benign Het
Psap A C 10: 60,299,496 L313F probably benign Het
Psen1 T A 12: 83,728,243 C263S probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Pura T A 18: 36,287,889 M243K probably damaging Het
Sec16b T C 1: 157,560,799 S579P probably benign Het
Sept1 T A 7: 127,214,950 E338V probably damaging Het
Sgms1 A G 19: 32,129,691 F255L probably benign Het
Slc4a2 A G 5: 24,432,864 T353A possibly damaging Het
Smg6 T C 11: 74,929,623 V240A probably benign Het
Sntg2 T G 12: 30,229,634 D340A possibly damaging Het
Sun1 C T 5: 139,235,720 P553S probably benign Het
Tas2r137 T C 6: 40,491,320 V28A probably damaging Het
Tfcp2l1 T C 1: 118,664,956 F323S probably damaging Het
Tpcn2 G A 7: 145,278,849 T90I possibly damaging Het
Ttc30a1 A C 2: 75,979,898 F614V probably damaging Het
Ttn A T 2: 76,889,977 Y6968* probably null Het
Vmn2r44 A T 7: 8,383,123 L39* probably null Het
Other mutations in Ank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ank3 APN 10 69982205 splice site probably benign
IGL00578:Ank3 APN 10 70002394 missense possibly damaging 0.95
IGL00851:Ank3 APN 10 69874833 missense probably damaging 0.99
IGL01067:Ank3 APN 10 69850196 missense probably damaging 1.00
IGL01483:Ank3 APN 10 69874809 missense probably damaging 1.00
IGL01549:Ank3 APN 10 69932420 missense probably damaging 1.00
IGL01576:Ank3 APN 10 69980291 missense probably damaging 1.00
IGL01601:Ank3 APN 10 70004725 missense possibly damaging 0.87
IGL02047:Ank3 APN 10 69892494 missense possibly damaging 0.94
IGL02088:Ank3 APN 10 69999373 missense probably damaging 1.00
IGL02159:Ank3 APN 10 69808892 missense probably damaging 1.00
IGL02249:Ank3 APN 10 69882370 missense probably damaging 1.00
IGL02942:Ank3 APN 10 69973877 missense probably damaging 1.00
IGL02979:Ank3 APN 10 70002099 missense probably benign 0.01
IGL03379:Ank3 APN 10 69973772 missense probably damaging 1.00
PIT4495001:Ank3 UTSW 10 69993072 missense
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0172:Ank3 UTSW 10 69976058 missense probably damaging 1.00
R0315:Ank3 UTSW 10 70002517 missense probably damaging 0.98
R0480:Ank3 UTSW 10 69879926 missense probably damaging 0.96
R0485:Ank3 UTSW 10 69882544 missense possibly damaging 0.89
R0511:Ank3 UTSW 10 69882368 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1165:Ank3 UTSW 10 69898302 missense possibly damaging 0.90
R1186:Ank3 UTSW 10 69867460 missense probably damaging 1.00
R1257:Ank3 UTSW 10 69874835 nonsense probably null
R1300:Ank3 UTSW 10 70004665 missense probably benign 0.03
R1391:Ank3 UTSW 10 69534280 missense possibly damaging 0.96
R1549:Ank3 UTSW 10 70001982 missense probably benign 0.18
R1586:Ank3 UTSW 10 69877878 missense probably damaging 0.98
R1619:Ank3 UTSW 10 69879975 missense probably damaging 1.00
R1643:Ank3 UTSW 10 69884802 missense probably benign 0.00
R1874:Ank3 UTSW 10 69898083 missense probably damaging 1.00
R1884:Ank3 UTSW 10 70015592 missense possibly damaging 0.53
R1901:Ank3 UTSW 10 69822337 missense probably damaging 1.00
R1986:Ank3 UTSW 10 69867428 missense probably damaging 1.00
R2051:Ank3 UTSW 10 69898090 missense probably damaging 0.97
R2273:Ank3 UTSW 10 69950942 splice site probably null
R2274:Ank3 UTSW 10 69950942 splice site probably null
R2421:Ank3 UTSW 10 69982204 splice site probably benign
R2434:Ank3 UTSW 10 70002118 missense probably damaging 1.00
R2969:Ank3 UTSW 10 69994395 missense probably damaging 1.00
R3426:Ank3 UTSW 10 69706894 missense probably benign
R3885:Ank3 UTSW 10 69899036 missense probably damaging 1.00
R3936:Ank3 UTSW 10 69879989 nonsense probably null
R4258:Ank3 UTSW 10 70004762 missense probably benign 0.33
R4320:Ank3 UTSW 10 69904246 missense possibly damaging 0.70
R4434:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4435:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4486:Ank3 UTSW 10 70001974 missense possibly damaging 0.86
R4489:Ank3 UTSW 10 69898256 missense probably damaging 1.00
R4492:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R4508:Ank3 UTSW 10 69892370 missense probably damaging 1.00
R4561:Ank3 UTSW 10 70002018 missense probably damaging 0.99
R4724:Ank3 UTSW 10 69706858 missense probably benign
R4751:Ank3 UTSW 10 69986206 missense probably benign 0.19
R4790:Ank3 UTSW 10 69988151 nonsense probably null
R4795:Ank3 UTSW 10 69858265 missense probably benign 0.36
R4921:Ank3 UTSW 10 70002109 missense probably damaging 1.00
R4932:Ank3 UTSW 10 69898223 splice site probably null
R4935:Ank3 UTSW 10 69976203 missense probably damaging 0.99
R4946:Ank3 UTSW 10 69898117 missense probably damaging 1.00
R5174:Ank3 UTSW 10 69892379 missense probably damaging 0.99
R5208:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5248:Ank3 UTSW 10 69987108 missense probably benign 0.00
R5255:Ank3 UTSW 10 69885200 missense probably damaging 1.00
R5307:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5308:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5373:Ank3 UTSW 10 69953476 splice site probably null
R5374:Ank3 UTSW 10 69953476 splice site probably null
R5502:Ank3 UTSW 10 69920461 missense probably benign 0.12
R5508:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5509:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5510:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5538:Ank3 UTSW 10 69987427 missense probably damaging 1.00
R5664:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5665:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5682:Ank3 UTSW 10 69893517 missense probably damaging 1.00
R5834:Ank3 UTSW 10 69822257 missense probably damaging 1.00
R5881:Ank3 UTSW 10 69986830 missense probably benign 0.31
R5914:Ank3 UTSW 10 69992944 intron probably benign
R5940:Ank3 UTSW 10 69920486 missense probably benign 0.00
R5952:Ank3 UTSW 10 69986463 missense probably benign 0.07
R5963:Ank3 UTSW 10 69987226 nonsense probably null
R6075:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6076:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6077:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6081:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6092:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6118:Ank3 UTSW 10 69994401 missense probably damaging 0.98
R6135:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6175:Ank3 UTSW 10 69927727 missense probably damaging 1.00
R6248:Ank3 UTSW 10 69973850 missense probably benign 0.10
R6249:Ank3 UTSW 10 69823076 critical splice acceptor site probably null
R6273:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6274:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6290:Ank3 UTSW 10 69991368 intron probably benign
R6298:Ank3 UTSW 10 69850176 missense probably damaging 1.00
R6349:Ank3 UTSW 10 69979439 missense probably damaging 1.00
R6366:Ank3 UTSW 10 69999358 missense probably damaging 1.00
R6371:Ank3 UTSW 10 69808879 missense probably damaging 1.00
R6459:Ank3 UTSW 10 69991747 intron probably benign
R6489:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6491:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6499:Ank3 UTSW 10 69991744 intron probably benign
R6520:Ank3 UTSW 10 69988387 missense probably damaging 1.00
R6521:Ank3 UTSW 10 69992766 intron probably benign
R6535:Ank3 UTSW 10 69877854 missense probably damaging 1.00
R6548:Ank3 UTSW 10 69892410 missense probably damaging 1.00
R6587:Ank3 UTSW 10 69990152 intron probably benign
R6624:Ank3 UTSW 10 69904468 missense possibly damaging 0.66
R6722:Ank3 UTSW 10 69990244 intron probably benign
R6729:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R6731:Ank3 UTSW 10 70014028 missense possibly damaging 0.70
R6742:Ank3 UTSW 10 69991582 intron probably benign
R6788:Ank3 UTSW 10 70004723 missense probably damaging 1.00
R6846:Ank3 UTSW 10 69824349 missense probably damaging 1.00
R6933:Ank3 UTSW 10 69904212 missense probably damaging 1.00
R7034:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7036:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7132:Ank3 UTSW 10 69989914 missense
R7171:Ank3 UTSW 10 69992481 missense
R7241:Ank3 UTSW 10 69706814 start codon destroyed probably null 0.11
R7386:Ank3 UTSW 10 69822249 missense unknown
R7445:Ank3 UTSW 10 69992124 missense
R7452:Ank3 UTSW 10 69899051 missense possibly damaging 0.53
R7492:Ank3 UTSW 10 69882527 missense unknown
R7512:Ank3 UTSW 10 69990861 missense
R7543:Ank3 UTSW 10 69951016 missense possibly damaging 0.96
R7577:Ank3 UTSW 10 69992572 missense
R7610:Ank3 UTSW 10 69986422 missense
R7673:Ank3 UTSW 10 69990501 missense
R7682:Ank3 UTSW 10 69988235 missense possibly damaging 0.53
R7814:Ank3 UTSW 10 69986904 missense
R7835:Ank3 UTSW 10 69987727 missense
R7843:Ank3 UTSW 10 69986958 missense probably benign 0.01
R7891:Ank3 UTSW 10 69988309 missense probably damaging 1.00
R8109:Ank3 UTSW 10 69990318 missense
R8175:Ank3 UTSW 10 69893509 missense unknown
R8210:Ank3 UTSW 10 69976095 missense possibly damaging 0.72
R8211:Ank3 UTSW 10 69867398 missense unknown
R8299:Ank3 UTSW 10 69976151 missense probably damaging 0.98
R8302:Ank3 UTSW 10 70004980 missense possibly damaging 0.73
R8516:Ank3 UTSW 10 69927729 nonsense probably null
R8543:Ank3 UTSW 10 70002436 missense probably damaging 1.00
R8549:Ank3 UTSW 10 69982182 missense possibly damaging 0.74
Z1176:Ank3 UTSW 10 69932474 missense possibly damaging 0.96
Z1176:Ank3 UTSW 10 69951010 missense possibly damaging 0.85
Z1176:Ank3 UTSW 10 69991215 missense
Predicted Primers PCR Primer
(F):5'- ATCAGAAAGACTTATCCCGGGG -3'
(R):5'- ACCCCTGTAACTCTGAGCTAGG -3'

Sequencing Primer
(F):5'- AGACTTATCCCGGGGAAATATTAAC -3'
(R):5'- TAACTCTGAGCTAGGGGGTCC -3'
Posted On2019-10-17