Incidental Mutation 'R7495:Med12l'
ID581026
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R7495 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59244773 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 993 (K993R)
Ref Sequence ENSEMBL: ENSMUSP00000127038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
AA Change: K958R

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: K958R

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164225
AA Change: K993R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: K993R

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000199659
AA Change: K993R

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: K993R

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,865,871 E1251G probably damaging Het
Apba1 T C 19: 23,936,599 probably null Het
Arap2 C T 5: 62,676,550 S858N possibly damaging Het
Capn10 T C 1: 92,943,370 F301L probably damaging Het
Catip T C 1: 74,362,692 W9R probably benign Het
Cfap46 A G 7: 139,603,196 probably null Het
Cpq C T 15: 33,302,440 R246C probably damaging Het
Dgkh A G 14: 78,578,799 S1067P probably benign Het
Dpp3 T C 19: 4,917,913 E316G probably damaging Het
Dpp9 T C 17: 56,195,044 Q508R probably benign Het
Frem2 T C 3: 53,516,837 N3060D probably benign Het
Fstl5 A G 3: 76,707,792 Y720C possibly damaging Het
Gm28168 T C 1: 117,947,907 S89P possibly damaging Het
Hk2 C T 6: 82,727,365 G900E probably damaging Het
Hrh1 A C 6: 114,480,673 D305A probably benign Het
Htt C T 5: 34,811,477 S435L probably benign Het
Ice2 G T 9: 69,416,229 V669L probably benign Het
Klk1b27 G A 7: 44,056,076 V191I probably benign Het
Nfe2l1 A G 11: 96,819,796 Y536H probably damaging Het
Nr4a2 T C 2: 57,112,159 D94G possibly damaging Het
Oit3 T C 10: 59,423,943 D546G possibly damaging Het
Paxbp1 T C 16: 91,016,949 T847A probably damaging Het
Pde12 A T 14: 26,668,839 N238K probably benign Het
Pfkfb3 A C 2: 11,482,501 I366S probably damaging Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptprb C A 10: 116,341,448 Q1018K probably benign Het
Rxfp3 C A 15: 11,035,925 G454C probably damaging Het
Scn5a A G 9: 119,543,134 V223A probably damaging Het
Sema4c C A 1: 36,550,693 V527L probably benign Het
Slk C A 19: 47,638,978 P1182T probably damaging Het
Stt3a A G 9: 36,747,939 V368A probably benign Het
Trpm3 T C 19: 22,897,796 F601L probably benign Het
Ttn T C 2: 76,709,955 D34229G probably benign Het
Vmn2r107 A G 17: 20,375,009 H608R possibly damaging Het
Vmn2r49 A T 7: 9,976,899 C635* probably null Het
Zfp473 A T 7: 44,737,944 F95Y probably benign Het
Zfp984 A C 4: 147,754,830 S521R possibly damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1501:Med12l UTSW 3 59260835 critical splice donor site probably null
R1544:Med12l UTSW 3 59265240 missense possibly damaging 0.71
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2070:Med12l UTSW 3 59244905 missense probably damaging 1.00
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3735:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4776:Med12l UTSW 3 59233212 missense probably damaging 1.00
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5125:Med12l UTSW 3 59267214 missense possibly damaging 0.83
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5596:Med12l UTSW 3 59252350 missense probably benign 0.45
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7110:Med12l UTSW 3 59262224 missense possibly damaging 0.92
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense probably damaging 1.00
R7159:Med12l UTSW 3 59276017 missense probably benign
R7341:Med12l UTSW 3 59042403 missense possibly damaging 0.53
R7349:Med12l UTSW 3 59258325 missense probably damaging 1.00
R7413:Med12l UTSW 3 59091550 missense probably benign 0.00
R7678:Med12l UTSW 3 59076720 missense probably damaging 1.00
R7697:Med12l UTSW 3 59240657 missense probably damaging 1.00
R7714:Med12l UTSW 3 59093586 missense probably benign 0.17
R7725:Med12l UTSW 3 59255992 missense probably damaging 1.00
R7846:Med12l UTSW 3 59264934 missense probably damaging 1.00
R7852:Med12l UTSW 3 59247911 missense probably damaging 1.00
R8080:Med12l UTSW 3 59265186 missense probably damaging 1.00
R8181:Med12l UTSW 3 59261968 missense probably damaging 1.00
R8223:Med12l UTSW 3 59086363 missense possibly damaging 0.79
RF004:Med12l UTSW 3 59275969 small insertion probably benign
RF011:Med12l UTSW 3 59275980 small insertion probably benign
RF013:Med12l UTSW 3 59275966 small insertion probably benign
RF020:Med12l UTSW 3 59275958 small insertion probably benign
RF021:Med12l UTSW 3 59073290 missense probably benign 0.19
RF027:Med12l UTSW 3 59275967 small insertion probably benign
RF027:Med12l UTSW 3 59275981 small insertion probably benign
RF030:Med12l UTSW 3 59275989 small insertion probably benign
RF032:Med12l UTSW 3 59275981 small insertion probably benign
RF032:Med12l UTSW 3 59275985 small insertion probably benign
RF032:Med12l UTSW 3 59275989 small insertion probably benign
RF033:Med12l UTSW 3 59275981 small insertion probably benign
RF033:Med12l UTSW 3 59275987 small insertion probably benign
RF033:Med12l UTSW 3 59275995 small insertion probably benign
RF037:Med12l UTSW 3 59275956 small insertion probably benign
RF040:Med12l UTSW 3 59275967 small insertion probably benign
RF040:Med12l UTSW 3 59275989 small insertion probably benign
RF041:Med12l UTSW 3 59275985 small insertion probably benign
RF041:Med12l UTSW 3 59275995 small insertion probably benign
RF042:Med12l UTSW 3 59275956 small insertion probably benign
RF042:Med12l UTSW 3 59275967 small insertion probably benign
RF042:Med12l UTSW 3 59275981 small insertion probably benign
RF042:Med12l UTSW 3 59275995 small insertion probably benign
RF049:Med12l UTSW 3 59275969 small insertion probably benign
RF050:Med12l UTSW 3 59275973 small insertion probably benign
RF053:Med12l UTSW 3 59275993 small insertion probably benign
RF055:Med12l UTSW 3 59275983 small insertion probably benign
RF056:Med12l UTSW 3 59275993 small insertion probably benign
RF057:Med12l UTSW 3 59275980 small insertion probably benign
RF063:Med12l UTSW 3 59275958 small insertion probably benign
RF063:Med12l UTSW 3 59275973 small insertion probably benign
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Z1176:Med12l UTSW 3 59091417 missense probably damaging 0.98
Z1176:Med12l UTSW 3 59244943 missense probably damaging 1.00
Z1176:Med12l UTSW 3 59296117 missense probably benign 0.00
Z1177:Med12l UTSW 3 59247875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGTGTGTAATTGGACCC -3'
(R):5'- TGTTGCACACAAAGCTGTAC -3'

Sequencing Primer
(F):5'- CCAATGCTGGTTTACAAAGATTTTGC -3'
(R):5'- CACACAAAGCTGTACCGGTTGG -3'
Posted On2019-10-17