Incidental Mutation 'R0633:Slitrk6'
ID 58103
Institutional Source Beutler Lab
Gene Symbol Slitrk6
Ensembl Gene ENSMUSG00000045871
Gene Name SLIT and NTRK-like family, member 6
Synonyms 4832410J21Rik
MMRRC Submission 038822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R0633 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 110986012-110992581 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110989317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 130 (D130G)
Ref Sequence ENSEMBL: ENSMUSP00000077492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078386]
AlphaFold Q8C110
Predicted Effect probably damaging
Transcript: ENSMUST00000078386
AA Change: D130G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: D130G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LRRNT 30 68 4e-15 BLAST
LRR 87 110 1.71e1 SMART
LRR 111 134 3.07e-1 SMART
LRR 135 158 4.44e0 SMART
LRR_TYP 159 182 2.09e-3 SMART
LRR 185 206 6.23e1 SMART
LRRCT 218 268 5.61e-5 SMART
low complexity region 287 301 N/A INTRINSIC
Blast:LRRNT 327 364 2e-17 BLAST
LRR 388 408 2.68e1 SMART
LRR_TYP 409 432 3.63e-3 SMART
LRR_TYP 433 456 6.23e-2 SMART
LRR_TYP 457 480 3.69e-4 SMART
low complexity region 501 513 N/A INTRINSIC
LRRCT 516 566 1.53e-6 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 634 642 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts8 A T 9: 30,854,807 (GRCm39) R18S probably damaging Het
Adgb G A 10: 10,267,473 (GRCm39) A923V probably benign Het
Aldh1a3 A G 7: 66,049,970 (GRCm39) V416A probably damaging Het
Alox5 C T 6: 116,397,345 (GRCm39) G280R probably damaging Het
Anapc5 A T 5: 122,938,695 (GRCm39) Y360N probably damaging Het
Apbb1 C T 7: 105,208,170 (GRCm39) V685I probably damaging Het
Apc2 C A 10: 80,143,289 (GRCm39) A463E probably damaging Het
Arhgap21 C T 2: 20,860,198 (GRCm39) W1170* probably null Het
Atat1 G A 17: 36,212,315 (GRCm39) R305C probably damaging Het
Brd8dc A G 18: 34,719,319 (GRCm39) V167A possibly damaging Het
Cars2 T C 8: 11,600,511 (GRCm39) D56G probably benign Het
Ccdc202 T G 14: 96,119,379 (GRCm39) N45K probably damaging Het
Cdc42bpb T C 12: 111,311,989 (GRCm39) I108V probably damaging Het
Cftr T A 6: 18,305,979 (GRCm39) I1255K probably damaging Het
Ckap5 T C 2: 91,381,088 (GRCm39) L148P probably damaging Het
Cntn4 A G 6: 106,656,209 (GRCm39) probably null Het
Cpe G A 8: 65,062,237 (GRCm39) P273L probably damaging Het
Cpsf7 A G 19: 10,509,146 (GRCm39) D19G probably benign Het
Ddx25 C A 9: 35,457,268 (GRCm39) R349L probably damaging Het
Depdc7 T C 2: 104,553,226 (GRCm39) D446G probably benign Het
Det1 T A 7: 78,493,683 (GRCm39) N107I probably benign Het
Dock6 A T 9: 21,755,713 (GRCm39) D170E probably benign Het
Dvl1 C T 4: 155,942,752 (GRCm39) L673F probably damaging Het
Gucy1b1 A T 3: 81,952,767 (GRCm39) I222K probably benign Het
Hfm1 T C 5: 107,065,467 (GRCm39) T71A possibly damaging Het
Ikzf1 A G 11: 11,719,223 (GRCm39) E310G probably damaging Het
Impg1 T C 9: 80,301,437 (GRCm39) E163G possibly damaging Het
Itpr2 G T 6: 146,275,954 (GRCm39) H426Q probably damaging Het
Itpripl2 C T 7: 118,089,479 (GRCm39) G360D probably benign Het
Kif14 C T 1: 136,455,043 (GRCm39) R1572C probably damaging Het
L3mbtl3 A T 10: 26,178,583 (GRCm39) H568Q unknown Het
Lgi2 A G 5: 52,711,802 (GRCm39) Y173H probably damaging Het
Lpar5 A C 6: 125,058,954 (GRCm39) Y225S probably benign Het
Lpin3 A G 2: 160,745,894 (GRCm39) H675R probably damaging Het
Lrp2 C A 2: 69,278,464 (GRCm39) G3963V probably damaging Het
Man1a2 G T 3: 100,591,891 (GRCm39) D13E possibly damaging Het
Map1a T C 2: 121,138,495 (GRCm39) V2753A probably damaging Het
Mitf C A 6: 97,980,865 (GRCm39) N97K probably damaging Het
Msh2 A G 17: 87,980,238 (GRCm39) probably null Het
Msr1 T C 8: 40,073,041 (GRCm39) E170G probably damaging Het
Myrip C A 9: 120,217,302 (GRCm39) R79S probably damaging Het
Nek10 G A 14: 14,857,782 (GRCm38) probably null Het
Neto1 C T 18: 86,422,854 (GRCm39) R104* probably null Het
Nom1 A C 5: 29,656,098 (GRCm39) K821T probably damaging Het
Nrxn1 A G 17: 91,011,609 (GRCm39) V340A probably damaging Het
Nxpe4 A T 9: 48,307,897 (GRCm39) I334F probably benign Het
Or1e23 A G 11: 73,407,753 (GRCm39) S91P probably benign Het
Or2ag1 T C 7: 106,313,184 (GRCm39) K235E probably benign Het
Or4a74 T C 2: 89,439,718 (GRCm39) M243V probably benign Het
Or5al7 T A 2: 85,992,435 (GRCm39) N286I probably damaging Het
Or5b124 T C 19: 13,610,700 (GRCm39) V75A probably damaging Het
Or8k27 C T 2: 86,275,473 (GRCm39) M284I probably benign Het
Padi4 A G 4: 140,484,896 (GRCm39) S322P probably damaging Het
Peli3 A G 19: 4,991,810 (GRCm39) Y44H probably damaging Het
Prdm4 A G 10: 85,743,767 (GRCm39) S163P probably damaging Het
Prom2 T C 2: 127,381,445 (GRCm39) D227G probably benign Het
Ptgfr C T 3: 151,507,400 (GRCm39) R321H probably benign Het
Resf1 A T 6: 149,227,199 (GRCm39) I82L probably benign Het
Rgs3 G A 4: 62,544,143 (GRCm39) R136H probably damaging Het
Rgsl1 T G 1: 153,719,853 (GRCm39) N3T possibly damaging Het
Rif1 T C 2: 52,002,575 (GRCm39) S2010P probably benign Het
Rngtt T C 4: 33,368,690 (GRCm39) F408L probably damaging Het
Rtn3 T G 19: 7,434,958 (GRCm39) T326P probably benign Het
Slc18b1 A C 10: 23,681,936 (GRCm39) M167L probably benign Het
Slc22a26 A G 19: 7,765,575 (GRCm39) probably null Het
Snap47 A G 11: 59,319,439 (GRCm39) V233A probably benign Het
Sumf1 A C 6: 108,121,632 (GRCm39) Y158D probably damaging Het
Tbc1d15 A T 10: 115,056,215 (GRCm39) H252Q probably benign Het
Thsd7b T C 1: 130,116,263 (GRCm39) S1339P possibly damaging Het
Tmem45a2 T C 16: 56,869,777 (GRCm39) I56V probably benign Het
Ttc21b A G 2: 66,066,577 (GRCm39) S359P probably benign Het
Ttc27 T C 17: 75,036,972 (GRCm39) I215T probably benign Het
Ttn C T 2: 76,554,539 (GRCm39) V30759I possibly damaging Het
Vdac3 T C 8: 23,070,404 (GRCm39) N168S probably damaging Het
Wdr7 T C 18: 63,998,371 (GRCm39) V1106A probably benign Het
Wrap73 T A 4: 154,226,948 (GRCm39) F16Y probably damaging Het
Zfat C A 15: 68,052,652 (GRCm39) D381Y probably damaging Het
Other mutations in Slitrk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Slitrk6 APN 14 110,988,547 (GRCm39) missense probably benign 0.35
IGL01131:Slitrk6 APN 14 110,989,008 (GRCm39) missense probably damaging 1.00
IGL01294:Slitrk6 APN 14 110,987,506 (GRCm39) missense probably benign
IGL01295:Slitrk6 APN 14 110,988,868 (GRCm39) missense possibly damaging 0.50
IGL01762:Slitrk6 APN 14 110,989,056 (GRCm39) missense probably damaging 1.00
IGL02165:Slitrk6 APN 14 110,989,249 (GRCm39) missense probably benign 0.41
IGL02546:Slitrk6 APN 14 110,987,226 (GRCm39) missense probably benign 0.18
IGL03103:Slitrk6 APN 14 110,987,373 (GRCm39) missense probably benign
PIT1430001:Slitrk6 UTSW 14 110,987,859 (GRCm39) missense possibly damaging 0.93
PIT4480001:Slitrk6 UTSW 14 110,987,257 (GRCm39) frame shift probably null
R0035:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0066:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0067:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0069:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0107:Slitrk6 UTSW 14 110,989,395 (GRCm39) missense possibly damaging 0.69
R0157:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110,989,725 (GRCm39) start gained probably benign
R0422:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0454:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0505:Slitrk6 UTSW 14 110,987,364 (GRCm39) missense probably damaging 1.00
R0711:Slitrk6 UTSW 14 110,987,251 (GRCm39) missense probably damaging 1.00
R0843:Slitrk6 UTSW 14 110,987,530 (GRCm39) missense probably benign
R1298:Slitrk6 UTSW 14 110,989,297 (GRCm39) missense possibly damaging 0.94
R1693:Slitrk6 UTSW 14 110,988,360 (GRCm39) missense probably damaging 1.00
R1756:Slitrk6 UTSW 14 110,987,984 (GRCm39) missense probably benign
R1998:Slitrk6 UTSW 14 110,989,255 (GRCm39) missense probably damaging 0.99
R2049:Slitrk6 UTSW 14 110,988,226 (GRCm39) missense probably benign 0.00
R2140:Slitrk6 UTSW 14 110,988,226 (GRCm39) missense probably benign 0.00
R2142:Slitrk6 UTSW 14 110,988,226 (GRCm39) missense probably benign 0.00
R2314:Slitrk6 UTSW 14 110,989,387 (GRCm39) missense probably damaging 1.00
R2566:Slitrk6 UTSW 14 110,987,704 (GRCm39) missense probably benign 0.00
R4231:Slitrk6 UTSW 14 110,988,820 (GRCm39) missense probably benign 0.02
R4236:Slitrk6 UTSW 14 110,987,580 (GRCm39) missense probably benign 0.07
R4247:Slitrk6 UTSW 14 110,988,171 (GRCm39) missense probably damaging 1.00
R4576:Slitrk6 UTSW 14 110,987,602 (GRCm39) missense probably benign 0.05
R4856:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4858:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4859:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4886:Slitrk6 UTSW 14 110,989,315 (GRCm39) missense probably damaging 1.00
R4931:Slitrk6 UTSW 14 110,987,811 (GRCm39) missense probably damaging 1.00
R5255:Slitrk6 UTSW 14 110,987,185 (GRCm39) makesense probably null
R5281:Slitrk6 UTSW 14 110,987,805 (GRCm39) missense probably damaging 1.00
R5450:Slitrk6 UTSW 14 110,987,529 (GRCm39) missense probably benign
R5579:Slitrk6 UTSW 14 110,988,649 (GRCm39) missense possibly damaging 0.82
R5689:Slitrk6 UTSW 14 110,989,558 (GRCm39) missense probably benign
R5935:Slitrk6 UTSW 14 110,987,305 (GRCm39) missense probably benign 0.00
R6016:Slitrk6 UTSW 14 110,987,958 (GRCm39) missense probably benign 0.00
R6312:Slitrk6 UTSW 14 110,987,679 (GRCm39) missense probably benign 0.00
R6890:Slitrk6 UTSW 14 110,988,528 (GRCm39) nonsense probably null
R6952:Slitrk6 UTSW 14 110,987,974 (GRCm39) missense probably benign
R7378:Slitrk6 UTSW 14 110,987,295 (GRCm39) missense probably damaging 1.00
R8354:Slitrk6 UTSW 14 110,989,478 (GRCm39) missense probably damaging 1.00
R8401:Slitrk6 UTSW 14 110,989,453 (GRCm39) missense possibly damaging 0.67
R8454:Slitrk6 UTSW 14 110,989,478 (GRCm39) missense probably damaging 1.00
R8807:Slitrk6 UTSW 14 110,988,123 (GRCm39) missense possibly damaging 0.77
R8814:Slitrk6 UTSW 14 110,987,370 (GRCm39) missense probably benign
R8826:Slitrk6 UTSW 14 110,988,801 (GRCm39) missense probably benign
R9681:Slitrk6 UTSW 14 110,988,258 (GRCm39) missense probably damaging 1.00
R9740:Slitrk6 UTSW 14 110,987,444 (GRCm39) missense probably benign 0.13
R9740:Slitrk6 UTSW 14 110,987,430 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCGACTCAGTACACTCCCTTTG -3'
(R):5'- CTTGACAATGCTTCACACGAACGAC -3'

Sequencing Primer
(F):5'- ACACTCCCTTTGAAAGGTGG -3'
(R):5'- CACGAACGACTTTTCTGGAC -3'
Posted On 2013-07-11