Incidental Mutation 'R7495:Arap2'
ID581031
Institutional Source Beutler Lab
Gene Symbol Arap2
Ensembl Gene ENSMUSG00000037999
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
SynonymsCentd1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7495 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location62602445-62766159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62676550 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 858 (S858N)
Ref Sequence ENSEMBL: ENSMUSP00000075924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076623
AA Change: S858N

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: S858N

DomainStartEndE-ValueType
SAM 3 70 3.69e-7 SMART
low complexity region 222 233 N/A INTRINSIC
PH 481 574 6.45e-17 SMART
PH 586 679 9.05e-12 SMART
ArfGap 684 805 9.2e-33 SMART
PH 891 1003 1.51e-8 SMART
PH 1013 1112 9.21e-4 SMART
RhoGAP 1124 1300 1.36e-50 SMART
Pfam:RA 1325 1416 2.1e-7 PFAM
PH 1429 1533 2.68e-14 SMART
coiled coil region 1561 1590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,865,871 E1251G probably damaging Het
Apba1 T C 19: 23,936,599 probably null Het
Capn10 T C 1: 92,943,370 F301L probably damaging Het
Catip T C 1: 74,362,692 W9R probably benign Het
Cfap46 A G 7: 139,603,196 probably null Het
Cpq C T 15: 33,302,440 R246C probably damaging Het
Dgkh A G 14: 78,578,799 S1067P probably benign Het
Dpp3 T C 19: 4,917,913 E316G probably damaging Het
Dpp9 T C 17: 56,195,044 Q508R probably benign Het
Frem2 T C 3: 53,516,837 N3060D probably benign Het
Fstl5 A G 3: 76,707,792 Y720C possibly damaging Het
Gm28168 T C 1: 117,947,907 S89P possibly damaging Het
Hk2 C T 6: 82,727,365 G900E probably damaging Het
Hrh1 A C 6: 114,480,673 D305A probably benign Het
Htt C T 5: 34,811,477 S435L probably benign Het
Ice2 G T 9: 69,416,229 V669L probably benign Het
Klk1b27 G A 7: 44,056,076 V191I probably benign Het
Med12l A G 3: 59,244,773 K993R probably damaging Het
Nfe2l1 A G 11: 96,819,796 Y536H probably damaging Het
Nr4a2 T C 2: 57,112,159 D94G possibly damaging Het
Oit3 T C 10: 59,423,943 D546G possibly damaging Het
Paxbp1 T C 16: 91,016,949 T847A probably damaging Het
Pde12 A T 14: 26,668,839 N238K probably benign Het
Pfkfb3 A C 2: 11,482,501 I366S probably damaging Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptprb C A 10: 116,341,448 Q1018K probably benign Het
Rxfp3 C A 15: 11,035,925 G454C probably damaging Het
Scn5a A G 9: 119,543,134 V223A probably damaging Het
Sema4c C A 1: 36,550,693 V527L probably benign Het
Slk C A 19: 47,638,978 P1182T probably damaging Het
Stt3a A G 9: 36,747,939 V368A probably benign Het
Trpm3 T C 19: 22,897,796 F601L probably benign Het
Ttn T C 2: 76,709,955 D34229G probably benign Het
Vmn2r107 A G 17: 20,375,009 H608R possibly damaging Het
Vmn2r49 A T 7: 9,976,899 C635* probably null Het
Zfp473 A T 7: 44,737,944 F95Y probably benign Het
Zfp984 A C 4: 147,754,830 S521R possibly damaging Het
Other mutations in Arap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Arap2 APN 5 62635962 missense probably damaging 1.00
IGL00642:Arap2 APN 5 62733058 nonsense probably null
IGL00705:Arap2 APN 5 62678023 missense probably damaging 1.00
IGL00942:Arap2 APN 5 62698389 nonsense probably null
IGL01069:Arap2 APN 5 62649856 missense probably benign
IGL01601:Arap2 APN 5 62641342 missense probably damaging 1.00
IGL01986:Arap2 APN 5 62621922 missense probably damaging 1.00
IGL02032:Arap2 APN 5 62670997 missense probably damaging 0.99
IGL02262:Arap2 APN 5 62642841 missense probably damaging 1.00
IGL02331:Arap2 APN 5 62649682 splice site probably benign
IGL02527:Arap2 APN 5 62749307 missense probably benign
IGL02803:Arap2 APN 5 62749109 missense probably benign
IGL02864:Arap2 APN 5 62677965 missense probably damaging 1.00
IGL03078:Arap2 APN 5 62733065 splice site probably benign
IGL03154:Arap2 APN 5 62642925 missense probably damaging 1.00
IGL03213:Arap2 APN 5 62749095 missense probably benign 0.00
IGL03279:Arap2 APN 5 62621910 missense probably damaging 1.00
IGL03288:Arap2 APN 5 62604616 missense probably benign 0.00
PIT4354001:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R0012:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0166:Arap2 UTSW 5 62676018 missense probably damaging 1.00
R0472:Arap2 UTSW 5 62706659 missense probably damaging 1.00
R0506:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0551:Arap2 UTSW 5 62641323 splice site probably null
R0607:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0617:Arap2 UTSW 5 62649907 splice site probably benign
R0975:Arap2 UTSW 5 62730886 splice site probably benign
R0976:Arap2 UTSW 5 62649884 missense probably damaging 1.00
R1164:Arap2 UTSW 5 62683477 missense probably damaging 1.00
R1268:Arap2 UTSW 5 62730621 missense probably benign 0.00
R1480:Arap2 UTSW 5 62669129 nonsense probably null
R1502:Arap2 UTSW 5 62604404 missense probably benign 0.00
R1543:Arap2 UTSW 5 62606155 nonsense probably null
R1865:Arap2 UTSW 5 62698263 missense probably damaging 0.97
R1962:Arap2 UTSW 5 62676664 missense possibly damaging 0.82
R2040:Arap2 UTSW 5 62748916 missense probably damaging 0.99
R2118:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2131:Arap2 UTSW 5 62677958 missense probably damaging 1.00
R2201:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2215:Arap2 UTSW 5 62677176 missense probably damaging 1.00
R3027:Arap2 UTSW 5 62669897 missense probably damaging 1.00
R3053:Arap2 UTSW 5 62748857 missense probably benign 0.35
R3975:Arap2 UTSW 5 62748894 missense possibly damaging 0.87
R4272:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4273:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4326:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4327:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4328:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4451:Arap2 UTSW 5 62749170 missense probably benign 0.06
R4659:Arap2 UTSW 5 62654126 missense possibly damaging 0.94
R4665:Arap2 UTSW 5 62669969 missense possibly damaging 0.95
R4715:Arap2 UTSW 5 62749094 missense probably benign 0.43
R4808:Arap2 UTSW 5 62730641 missense probably benign 0.23
R4941:Arap2 UTSW 5 62749478 missense probably benign 0.20
R4983:Arap2 UTSW 5 62676525 missense probably damaging 0.98
R5095:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R5156:Arap2 UTSW 5 62669181 nonsense probably null
R5201:Arap2 UTSW 5 62683489 missense probably damaging 1.00
R5346:Arap2 UTSW 5 62714746 missense probably benign 0.39
R5359:Arap2 UTSW 5 62683419 nonsense probably null
R5426:Arap2 UTSW 5 62642816 missense probably benign 0.02
R5503:Arap2 UTSW 5 62630186 missense probably damaging 1.00
R5605:Arap2 UTSW 5 62615067 missense possibly damaging 0.47
R5764:Arap2 UTSW 5 62642854 missense probably damaging 1.00
R5813:Arap2 UTSW 5 62677163 missense probably damaging 1.00
R5846:Arap2 UTSW 5 62649773 missense probably damaging 1.00
R6084:Arap2 UTSW 5 62670954 missense possibly damaging 0.89
R6173:Arap2 UTSW 5 62749622 missense probably damaging 1.00
R6175:Arap2 UTSW 5 62714731 critical splice donor site probably null
R6249:Arap2 UTSW 5 62646193 missense probably damaging 0.99
R6386:Arap2 UTSW 5 62604522 missense possibly damaging 0.89
R6424:Arap2 UTSW 5 62683364 missense probably damaging 1.00
R6744:Arap2 UTSW 5 62748938 missense probably damaging 1.00
R6766:Arap2 UTSW 5 62677100 critical splice donor site probably null
R6990:Arap2 UTSW 5 62676517 missense probably damaging 0.96
R7067:Arap2 UTSW 5 62654044 critical splice donor site probably null
R7098:Arap2 UTSW 5 62675950 critical splice donor site probably null
R7107:Arap2 UTSW 5 62606208 missense probably damaging 0.98
R7156:Arap2 UTSW 5 62604571 missense probably damaging 1.00
R7174:Arap2 UTSW 5 62604278 missense probably benign
R7187:Arap2 UTSW 5 62669053 missense probably damaging 0.99
R7197:Arap2 UTSW 5 62641386 missense possibly damaging 0.89
R7214:Arap2 UTSW 5 62749338 missense probably benign 0.00
R7317:Arap2 UTSW 5 62649724 missense probably damaging 1.00
R7392:Arap2 UTSW 5 62698385 missense possibly damaging 0.54
R7438:Arap2 UTSW 5 62749475 missense probably damaging 0.99
R7452:Arap2 UTSW 5 62676549 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGCAAAGAAGCACACACTTAAGC -3'
(R):5'- AGCTGGACTCACATTCACTTC -3'

Sequencing Primer
(F):5'- GAAGCACACACTTAAGCCATAG -3'
(R):5'- CCCACCAATGTCCTTTGAATGCATAG -3'
Posted On2019-10-17