Incidental Mutation 'R7495:Klk1b27'
ID 581035
Institutional Source Beutler Lab
Gene Symbol Klk1b27
Ensembl Gene ENSMUSG00000063177
Gene Name kallikrein 1-related peptidase b27
Synonyms mGK-27, Klk27, Klk21l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 44052290-44056712 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 44056076 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 191 (V191I)
Ref Sequence ENSEMBL: ENSMUSP00000078786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079859]
AlphaFold Q9JM71
Predicted Effect probably benign
Transcript: ENSMUST00000079859
AA Change: V191I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078786
Gene: ENSMUSG00000063177
AA Change: V191I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.87e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,865,871 E1251G probably damaging Het
Apba1 T C 19: 23,936,599 probably null Het
Arap2 C T 5: 62,676,550 S858N possibly damaging Het
Capn10 T C 1: 92,943,370 F301L probably damaging Het
Catip T C 1: 74,362,692 W9R probably benign Het
Cfap46 A G 7: 139,603,196 probably null Het
Cpq C T 15: 33,302,440 R246C probably damaging Het
Dgkh A G 14: 78,578,799 S1067P probably benign Het
Dpp3 T C 19: 4,917,913 E316G probably damaging Het
Dpp9 T C 17: 56,195,044 Q508R probably benign Het
Frem2 T C 3: 53,516,837 N3060D probably benign Het
Fstl5 A G 3: 76,707,792 Y720C possibly damaging Het
Gm28168 T C 1: 117,947,907 S89P possibly damaging Het
Hk2 C T 6: 82,727,365 G900E probably damaging Het
Hrh1 A C 6: 114,480,673 D305A probably benign Het
Htt C T 5: 34,811,477 S435L probably benign Het
Ice2 G T 9: 69,416,229 V669L probably benign Het
Med12l A G 3: 59,244,773 K993R probably damaging Het
Nfe2l1 A G 11: 96,819,796 Y536H probably damaging Het
Nr4a2 T C 2: 57,112,159 D94G possibly damaging Het
Oit3 T C 10: 59,423,943 D546G possibly damaging Het
Paxbp1 T C 16: 91,016,949 T847A probably damaging Het
Pde12 A T 14: 26,668,839 N238K probably benign Het
Pfkfb3 A C 2: 11,482,501 I366S probably damaging Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptprb C A 10: 116,341,448 Q1018K probably benign Het
Rxfp3 C A 15: 11,035,925 G454C probably damaging Het
Scn5a A G 9: 119,543,134 V223A probably damaging Het
Sema4c C A 1: 36,550,693 V527L probably benign Het
Slk C A 19: 47,638,978 P1182T probably damaging Het
Stt3a A G 9: 36,747,939 V368A probably benign Het
Trpm3 T C 19: 22,897,796 F601L probably benign Het
Ttn T C 2: 76,709,955 D34229G probably benign Het
Vmn2r107 A G 17: 20,375,009 H608R possibly damaging Het
Vmn2r49 A T 7: 9,976,899 C635* probably null Het
Zfp473 A T 7: 44,737,944 F95Y probably benign Het
Zfp984 A C 4: 147,754,830 S521R possibly damaging Het
Other mutations in Klk1b27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Klk1b27 APN 7 44056143 critical splice donor site probably null
IGL01328:Klk1b27 APN 7 44055879 missense probably damaging 1.00
IGL01552:Klk1b27 APN 7 44054615 missense probably damaging 1.00
IGL01632:Klk1b27 APN 7 44056673 utr 3 prime probably benign
R0574:Klk1b27 UTSW 7 44056101 missense probably damaging 1.00
R4723:Klk1b27 UTSW 7 44056532 missense probably damaging 1.00
R5800:Klk1b27 UTSW 7 44055664 missense probably benign 0.21
R6002:Klk1b27 UTSW 7 44055690 missense probably benign
R6244:Klk1b27 UTSW 7 44054550 missense probably benign 0.05
R6513:Klk1b27 UTSW 7 44055745 missense probably benign 0.00
R6584:Klk1b27 UTSW 7 44054511 missense possibly damaging 0.84
R6633:Klk1b27 UTSW 7 44055810 missense probably damaging 0.98
R7074:Klk1b27 UTSW 7 44056553 missense probably damaging 1.00
R7830:Klk1b27 UTSW 7 44055726 missense probably benign 0.00
R8002:Klk1b27 UTSW 7 44056021 missense probably benign 0.01
R8969:Klk1b27 UTSW 7 44054508 missense probably damaging 0.99
R8994:Klk1b27 UTSW 7 44055712 missense probably damaging 1.00
R9020:Klk1b27 UTSW 7 44055694 missense probably damaging 1.00
R9104:Klk1b27 UTSW 7 44055886 nonsense probably null
X0024:Klk1b27 UTSW 7 44056593 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGCTGTGAAGCCCATCGAC -3'
(R):5'- ATTCTATGGGGAAGGTTTCAAAGAG -3'

Sequencing Primer
(F):5'- GAGCACATGCCTAGCCTCAG -3'
(R):5'- GTTTCAAAGAGCCTGCCTAGTCAG -3'
Posted On 2019-10-17