Mutagenetix > Incidental Mutation

Incidental Mutation 'R7495:Oit3'

581041

Institutional Source

Beutler Lab

Gene Symbol

Oit3

Ensembl Gene

ENSMUSG00000009654

Gene Name

oncoprotein induced transcript 3

Synonyms

EF-9

MMRRC Submission

045568-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R7495 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59422958-59441778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59423943 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 546 (D546G)

Ref Sequence

ENSEMBL: ENSMUSP00000009798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009790] [ENSMUST00000009798] [ENSMUST00000162643]

AlphaFold

Q8R4V5

Predicted Effect

probably benign
Transcript: ENSMUST00000009790

SMART Domains

Protein: ENSMUSP00000009790
Gene: ENSMUSG00000009646

Domain	Start	End	E-Value	Type
Pfam:PLA2G12	12	195	1.5e-89	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000009798
AA Change: D546G

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: D546G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:ZP	50	144	9e-24	BLAST
EGF	150	181	2.16e1	SMART
EGF	185	222	2.94e-3	SMART
EGF	226	263	2.35e-2	SMART
ZP	267	516	2.74e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000162643

SMART Domains

Protein: ENSMUSP00000123842
Gene: ENSMUSG00000009646

Domain	Start	End	E-Value	Type
Pfam:PLA2G12	1	77	1.7e-36	PFAM
low complexity region	90	101	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	A	G	5: 8,865,871	E1251G	probably damaging	Het
Apba1	T	C	19: 23,936,599		probably null	Het
Arap2	C	T	5: 62,676,550	S858N	possibly damaging	Het
Capn10	T	C	1: 92,943,370	F301L	probably damaging	Het
Catip	T	C	1: 74,362,692	W9R	probably benign	Het
Cfap46	A	G	7: 139,603,196		probably null	Het
Cpq	C	T	15: 33,302,440	R246C	probably damaging	Het
Dgkh	A	G	14: 78,578,799	S1067P	probably benign	Het
Dpp3	T	C	19: 4,917,913	E316G	probably damaging	Het
Dpp9	T	C	17: 56,195,044	Q508R	probably benign	Het
Frem2	T	C	3: 53,516,837	N3060D	probably benign	Het
Fstl5	A	G	3: 76,707,792	Y720C	possibly damaging	Het
Gm28168	T	C	1: 117,947,907	S89P	possibly damaging	Het
Hk2	C	T	6: 82,727,365	G900E	probably damaging	Het
Hrh1	A	C	6: 114,480,673	D305A	probably benign	Het
Htt	C	T	5: 34,811,477	S435L	probably benign	Het
Ice2	G	T	9: 69,416,229	V669L	probably benign	Het
Klk1b27	G	A	7: 44,056,076	V191I	probably benign	Het
Med12l	A	G	3: 59,244,773	K993R	probably damaging	Het
Nfe2l1	A	G	11: 96,819,796	Y536H	probably damaging	Het
Nr4a2	T	C	2: 57,112,159	D94G	possibly damaging	Het
Paxbp1	T	C	16: 91,016,949	T847A	probably damaging	Het
Pde12	A	T	14: 26,668,839	N238K	probably benign	Het
Pfkfb3	A	C	2: 11,482,501	I366S	probably damaging	Het
Ptma	GGAAGAAG	GGAAGAAGAAG	1: 86,529,539		probably benign	Het
Ptprb	C	A	10: 116,341,448	Q1018K	probably benign	Het
Rxfp3	C	A	15: 11,035,925	G454C	probably damaging	Het
Scn5a	A	G	9: 119,543,134	V223A	probably damaging	Het
Sema4c	C	A	1: 36,550,693	V527L	probably benign	Het
Slk	C	A	19: 47,638,978	P1182T	probably damaging	Het
Stt3a	A	G	9: 36,747,939	V368A	probably benign	Het
Trpm3	T	C	19: 22,897,796	F601L	probably benign	Het
Ttn	T	C	2: 76,709,955	D34229G	probably benign	Het
Vmn2r107	A	G	17: 20,375,009	H608R	possibly damaging	Het
Vmn2r49	A	T	7: 9,976,899	C635*	probably null	Het
Zfp473	A	T	7: 44,737,944	F95Y	probably benign	Het
Zfp984	A	C	4: 147,754,830	S521R	possibly damaging	Het

Other mutations in Oit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Oit3	APN	10	59425484	unclassified	probably benign
IGL01665:Oit3	APN	10	59438909	missense	probably damaging	1.00
IGL01839:Oit3	APN	10	59429496	missense	probably damaging	0.98
IGL02028:Oit3	APN	10	59438655	missense	probably damaging	0.98
PIT4585001:Oit3	UTSW	10	59431013	missense	possibly damaging	0.54
R0567:Oit3	UTSW	10	59435978	missense	probably damaging	0.99
R0781:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1110:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1563:Oit3	UTSW	10	59428074	missense	probably damaging	1.00
R1623:Oit3	UTSW	10	59428239	missense	probably damaging	0.99
R1693:Oit3	UTSW	10	59425417	missense	probably damaging	1.00
R1754:Oit3	UTSW	10	59427940	splice site	probably null
R1853:Oit3	UTSW	10	59441622	critical splice donor site	probably null
R2070:Oit3	UTSW	10	59431013	missense	probably benign	0.03
R2211:Oit3	UTSW	10	59428070	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59428345	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59441685	start gained	probably benign
R3103:Oit3	UTSW	10	59438891	missense	probably damaging	0.98
R4414:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4415:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4416:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4417:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4584:Oit3	UTSW	10	59425462	missense	probably damaging	1.00
R4734:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4748:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4749:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R5070:Oit3	UTSW	10	59424027	missense	probably damaging	1.00
R5521:Oit3	UTSW	10	59435914	missense	probably benign
R6326:Oit3	UTSW	10	59428239	missense	probably damaging	1.00
R6490:Oit3	UTSW	10	59438552	missense	possibly damaging	0.92
R6526:Oit3	UTSW	10	59429640	missense	probably damaging	1.00
R6766:Oit3	UTSW	10	59438712	missense	probably damaging	0.99
R6921:Oit3	UTSW	10	59435945	missense	probably damaging	0.99
R7129:Oit3	UTSW	10	59428344	missense	probably damaging	0.99
R7440:Oit3	UTSW	10	59429570	missense	probably damaging	0.99
R7512:Oit3	UTSW	10	59438894	missense	probably damaging	1.00
R7866:Oit3	UTSW	10	59424030	missense	probably benign	0.03
R8312:Oit3	UTSW	10	59438810	missense	probably benign	0.01
R8321:Oit3	UTSW	10	59428160	missense	probably benign	0.00
R8919:Oit3	UTSW	10	59441646	missense	unknown
R9131:Oit3	UTSW	10	59435929	missense	probably benign	0.01
R9457:Oit3	UTSW	10	59441683	start codon destroyed	unknown
R9478:Oit3	UTSW	10	59438642	missense	probably damaging	0.99
R9502:Oit3	UTSW	10	59428351	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCCGTGATTTGGACGAAC -3'
(R):5'- AACTGAGAGGTACTGTGTTGGC -3'

Sequencing Primer
(F):5'- CCGTGATTTGGACGAACTCAGG -3'
(R):5'- GCCTACAGTGACAATTGACTGTC -3'

Posted On

2019-10-17