Incidental Mutation 'R7495:Pde12'
ID581044
Institutional Source Beutler Lab
Gene Symbol Pde12
Ensembl Gene ENSMUSG00000043702
Gene Namephosphodiesterase 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7495 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location26659958-26669883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26668839 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 238 (N238K)
Ref Sequence ENSEMBL: ENSMUSP00000059666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052932]
Predicted Effect probably benign
Transcript: ENSMUST00000052932
AA Change: N238K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000059666
Gene: ENSMUSG00000043702
AA Change: N238K

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
Pfam:Exo_endo_phos 297 598 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167376
SMART Domains Protein: ENSMUSP00000127272
Gene: ENSMUSG00000021877

DomainStartEndE-ValueType
Pfam:Arf 1 60 4.2e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,865,871 E1251G probably damaging Het
Apba1 T C 19: 23,936,599 probably null Het
Arap2 C T 5: 62,676,550 S858N possibly damaging Het
Capn10 T C 1: 92,943,370 F301L probably damaging Het
Catip T C 1: 74,362,692 W9R probably benign Het
Cfap46 A G 7: 139,603,196 probably null Het
Cpq C T 15: 33,302,440 R246C probably damaging Het
Dgkh A G 14: 78,578,799 S1067P probably benign Het
Dpp3 T C 19: 4,917,913 E316G probably damaging Het
Dpp9 T C 17: 56,195,044 Q508R probably benign Het
Frem2 T C 3: 53,516,837 N3060D probably benign Het
Fstl5 A G 3: 76,707,792 Y720C possibly damaging Het
Gm28168 T C 1: 117,947,907 S89P possibly damaging Het
Hk2 C T 6: 82,727,365 G900E probably damaging Het
Hrh1 A C 6: 114,480,673 D305A probably benign Het
Htt C T 5: 34,811,477 S435L probably benign Het
Ice2 G T 9: 69,416,229 V669L probably benign Het
Klk1b27 G A 7: 44,056,076 V191I probably benign Het
Med12l A G 3: 59,244,773 K993R probably damaging Het
Nfe2l1 A G 11: 96,819,796 Y536H probably damaging Het
Nr4a2 T C 2: 57,112,159 D94G possibly damaging Het
Oit3 T C 10: 59,423,943 D546G possibly damaging Het
Paxbp1 T C 16: 91,016,949 T847A probably damaging Het
Pfkfb3 A C 2: 11,482,501 I366S probably damaging Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptprb C A 10: 116,341,448 Q1018K probably benign Het
Rxfp3 C A 15: 11,035,925 G454C probably damaging Het
Scn5a A G 9: 119,543,134 V223A probably damaging Het
Sema4c C A 1: 36,550,693 V527L probably benign Het
Slk C A 19: 47,638,978 P1182T probably damaging Het
Stt3a A G 9: 36,747,939 V368A probably benign Het
Trpm3 T C 19: 22,897,796 F601L probably benign Het
Ttn T C 2: 76,709,955 D34229G probably benign Het
Vmn2r107 A G 17: 20,375,009 H608R possibly damaging Het
Vmn2r49 A T 7: 9,976,899 C635* probably null Het
Zfp473 A T 7: 44,737,944 F95Y probably benign Het
Zfp984 A C 4: 147,754,830 S521R possibly damaging Het
Other mutations in Pde12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Pde12 APN 14 26666464 unclassified probably benign
IGL02306:Pde12 APN 14 26668378 missense possibly damaging 0.83
IGL02630:Pde12 APN 14 26666397 missense probably damaging 1.00
IGL02830:Pde12 APN 14 26668585 missense probably damaging 1.00
IGL03268:Pde12 APN 14 26668459 missense probably benign 0.32
R1727:Pde12 UTSW 14 26668867 missense probably benign 0.02
R2057:Pde12 UTSW 14 26668880 missense probably benign
R2059:Pde12 UTSW 14 26668880 missense probably benign
R2510:Pde12 UTSW 14 26665526 makesense probably null
R4174:Pde12 UTSW 14 26668989 missense probably benign 0.00
R5121:Pde12 UTSW 14 26669422 nonsense probably null
R5190:Pde12 UTSW 14 26666377 critical splice donor site probably null
R5387:Pde12 UTSW 14 26666453 missense probably benign 0.00
R5847:Pde12 UTSW 14 26665631 missense possibly damaging 0.96
R5987:Pde12 UTSW 14 26669098 missense probably benign 0.02
R8021:Pde12 UTSW 14 26665699 nonsense probably null
R8865:Pde12 UTSW 14 26669125 missense possibly damaging 0.51
R8898:Pde12 UTSW 14 26669422 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTGCCAGGATGTTGTAGGAG -3'
(R):5'- CTACATCATGGCTGGCTTCC -3'

Sequencing Primer
(F):5'- CCAGGATGTTGTAGGAGACAGTGC -3'
(R):5'- TGTGTGCCCCAAACTCG -3'
Posted On2019-10-17