Incidental Mutation 'R7495:Cpq'
ID581047
Institutional Source Beutler Lab
Gene Symbol Cpq
Ensembl Gene ENSMUSG00000039007
Gene Namecarboxypeptidase Q
Synonyms2610034C17Rik, HLS2, Lal-1, Pgcp, 1190003P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.672) question?
Stock #R7495 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location33083129-33594552 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33302440 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 246 (R246C)
Ref Sequence ENSEMBL: ENSMUSP00000039046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042167] [ENSMUST00000228916]
Predicted Effect probably damaging
Transcript: ENSMUST00000042167
AA Change: R246C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039046
Gene: ENSMUSG00000039007
AA Change: R246C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 186 199 N/A INTRINSIC
Pfam:Peptidase_M28 268 457 5.9e-29 PFAM
Pfam:Peptidase_M20 284 457 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228916
AA Change: R246C

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallopeptidase that belongs to the peptidase M28 family. The encoded protein may catalyze the cleavage of dipeptides with unsubstituted terminals into amino acids. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,865,871 E1251G probably damaging Het
Apba1 T C 19: 23,936,599 probably null Het
Arap2 C T 5: 62,676,550 S858N possibly damaging Het
Capn10 T C 1: 92,943,370 F301L probably damaging Het
Catip T C 1: 74,362,692 W9R probably benign Het
Cfap46 A G 7: 139,603,196 probably null Het
Dgkh A G 14: 78,578,799 S1067P probably benign Het
Dpp3 T C 19: 4,917,913 E316G probably damaging Het
Dpp9 T C 17: 56,195,044 Q508R probably benign Het
Frem2 T C 3: 53,516,837 N3060D probably benign Het
Fstl5 A G 3: 76,707,792 Y720C possibly damaging Het
Gm28168 T C 1: 117,947,907 S89P possibly damaging Het
Hk2 C T 6: 82,727,365 G900E probably damaging Het
Hrh1 A C 6: 114,480,673 D305A probably benign Het
Htt C T 5: 34,811,477 S435L probably benign Het
Ice2 G T 9: 69,416,229 V669L probably benign Het
Klk1b27 G A 7: 44,056,076 V191I probably benign Het
Med12l A G 3: 59,244,773 K993R probably damaging Het
Nfe2l1 A G 11: 96,819,796 Y536H probably damaging Het
Nr4a2 T C 2: 57,112,159 D94G possibly damaging Het
Oit3 T C 10: 59,423,943 D546G possibly damaging Het
Paxbp1 T C 16: 91,016,949 T847A probably damaging Het
Pde12 A T 14: 26,668,839 N238K probably benign Het
Pfkfb3 A C 2: 11,482,501 I366S probably damaging Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptprb C A 10: 116,341,448 Q1018K probably benign Het
Rxfp3 C A 15: 11,035,925 G454C probably damaging Het
Scn5a A G 9: 119,543,134 V223A probably damaging Het
Sema4c C A 1: 36,550,693 V527L probably benign Het
Slk C A 19: 47,638,978 P1182T probably damaging Het
Stt3a A G 9: 36,747,939 V368A probably benign Het
Trpm3 T C 19: 22,897,796 F601L probably benign Het
Ttn T C 2: 76,709,955 D34229G probably benign Het
Vmn2r107 A G 17: 20,375,009 H608R possibly damaging Het
Vmn2r49 A T 7: 9,976,899 C635* probably null Het
Zfp473 A T 7: 44,737,944 F95Y probably benign Het
Zfp984 A C 4: 147,754,830 S521R possibly damaging Het
Other mutations in Cpq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Cpq APN 15 33497287 missense probably benign
IGL01773:Cpq APN 15 33212850 missense probably benign 0.42
IGL02406:Cpq APN 15 33302508 missense probably damaging 1.00
IGL02527:Cpq APN 15 33302363 missense probably damaging 1.00
IGL02596:Cpq APN 15 33213014 missense probably damaging 1.00
IGL02642:Cpq APN 15 33381400 missense probably damaging 0.99
IGL03382:Cpq APN 15 33212943 missense probably damaging 0.96
R0309:Cpq UTSW 15 33594151 missense probably damaging 1.00
R1545:Cpq UTSW 15 33250000 missense probably damaging 1.00
R1698:Cpq UTSW 15 33250126 missense probably benign 0.45
R1967:Cpq UTSW 15 33497202 missense possibly damaging 0.65
R2321:Cpq UTSW 15 33594145 missense probably benign
R2431:Cpq UTSW 15 33594119 nonsense probably null
R4705:Cpq UTSW 15 33497338 missense probably benign
R5087:Cpq UTSW 15 33212862 missense probably benign 0.08
R5367:Cpq UTSW 15 33213104 missense possibly damaging 0.91
R5790:Cpq UTSW 15 33249997 missense probably damaging 1.00
R6347:Cpq UTSW 15 33290186 splice site probably null
R7319:Cpq UTSW 15 33250039 missense probably benign 0.02
R7711:Cpq UTSW 15 33497347 missense probably benign 0.04
R7806:Cpq UTSW 15 33497297 missense possibly damaging 0.83
R7945:Cpq UTSW 15 33594236 missense probably benign
X0063:Cpq UTSW 15 33213252 missense probably damaging 1.00
Z1176:Cpq UTSW 15 33381391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAACGTCAGTGAAAGTTACGGTC -3'
(R):5'- GAGGACCATCTCCACAGATTC -3'

Sequencing Primer
(F):5'- AGTCCTCACACAGGTATTC -3'
(R):5'- CCTTGTCACTATTCTAAAAATGGCC -3'
Posted On2019-10-17