Incidental Mutation 'R7495:Dpp9'
ID581050
Institutional Source Beutler Lab
Gene Symbol Dpp9
Ensembl Gene ENSMUSG00000001229
Gene Namedipeptidylpeptidase 9
SynonymsDPRP2, 6430584G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7495 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location56186807-56218889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56195044 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 508 (Q508R)
Ref Sequence ENSEMBL: ENSMUSP00000046604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038794]
Predicted Effect probably benign
Transcript: ENSMUST00000038794
AA Change: Q508R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046604
Gene: ENSMUSG00000001229
AA Change: Q508R

DomainStartEndE-ValueType
low complexity region 122 133 N/A INTRINSIC
Pfam:DPPIV_N 145 569 5.2e-109 PFAM
Pfam:Peptidase_S15 617 793 2.8e-10 PFAM
Pfam:Peptidase_S9 657 862 2.5e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants display partial neonatal lethality and complete lethality at preweaning stages with defects suckling due to undeveveloped tongue muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,865,871 E1251G probably damaging Het
Apba1 T C 19: 23,936,599 probably null Het
Arap2 C T 5: 62,676,550 S858N possibly damaging Het
Capn10 T C 1: 92,943,370 F301L probably damaging Het
Catip T C 1: 74,362,692 W9R probably benign Het
Cfap46 A G 7: 139,603,196 probably null Het
Cpq C T 15: 33,302,440 R246C probably damaging Het
Dgkh A G 14: 78,578,799 S1067P probably benign Het
Dpp3 T C 19: 4,917,913 E316G probably damaging Het
Frem2 T C 3: 53,516,837 N3060D probably benign Het
Fstl5 A G 3: 76,707,792 Y720C possibly damaging Het
Gm28168 T C 1: 117,947,907 S89P possibly damaging Het
Hk2 C T 6: 82,727,365 G900E probably damaging Het
Hrh1 A C 6: 114,480,673 D305A probably benign Het
Htt C T 5: 34,811,477 S435L probably benign Het
Ice2 G T 9: 69,416,229 V669L probably benign Het
Klk1b27 G A 7: 44,056,076 V191I probably benign Het
Med12l A G 3: 59,244,773 K993R probably damaging Het
Nfe2l1 A G 11: 96,819,796 Y536H probably damaging Het
Nr4a2 T C 2: 57,112,159 D94G possibly damaging Het
Oit3 T C 10: 59,423,943 D546G possibly damaging Het
Paxbp1 T C 16: 91,016,949 T847A probably damaging Het
Pde12 A T 14: 26,668,839 N238K probably benign Het
Pfkfb3 A C 2: 11,482,501 I366S probably damaging Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptprb C A 10: 116,341,448 Q1018K probably benign Het
Rxfp3 C A 15: 11,035,925 G454C probably damaging Het
Scn5a A G 9: 119,543,134 V223A probably damaging Het
Sema4c C A 1: 36,550,693 V527L probably benign Het
Slk C A 19: 47,638,978 P1182T probably damaging Het
Stt3a A G 9: 36,747,939 V368A probably benign Het
Trpm3 T C 19: 22,897,796 F601L probably benign Het
Ttn T C 2: 76,709,955 D34229G probably benign Het
Vmn2r107 A G 17: 20,375,009 H608R possibly damaging Het
Vmn2r49 A T 7: 9,976,899 C635* probably null Het
Zfp473 A T 7: 44,737,944 F95Y probably benign Het
Zfp984 A C 4: 147,754,830 S521R possibly damaging Het
Other mutations in Dpp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Dpp9 APN 17 56205240 missense probably damaging 0.99
IGL00920:Dpp9 APN 17 56200599 missense probably benign 0.01
IGL01568:Dpp9 APN 17 56191159 missense probably benign
IGL01583:Dpp9 APN 17 56211666 missense probably benign 0.00
IGL01613:Dpp9 APN 17 56190713 missense probably benign
IGL03371:Dpp9 APN 17 56187377 missense probably benign 0.00
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0418:Dpp9 UTSW 17 56194404 splice site probably benign
R1163:Dpp9 UTSW 17 56199426 missense possibly damaging 0.90
R1680:Dpp9 UTSW 17 56190103 missense probably benign 0.00
R1709:Dpp9 UTSW 17 56194431 missense probably benign
R1762:Dpp9 UTSW 17 56188362 missense probably damaging 1.00
R1809:Dpp9 UTSW 17 56199038 missense probably damaging 1.00
R1853:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R1854:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R2162:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R2205:Dpp9 UTSW 17 56199287 missense possibly damaging 0.87
R2301:Dpp9 UTSW 17 56194973 missense probably benign 0.00
R2520:Dpp9 UTSW 17 56206868 missense probably damaging 1.00
R3831:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R3833:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R4364:Dpp9 UTSW 17 56187391 missense possibly damaging 0.79
R4737:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4740:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4741:Dpp9 UTSW 17 56205286 missense probably benign
R4798:Dpp9 UTSW 17 56191016 missense probably damaging 0.96
R4806:Dpp9 UTSW 17 56190030 missense probably damaging 1.00
R5375:Dpp9 UTSW 17 56189424 nonsense probably null
R5709:Dpp9 UTSW 17 56189393 missense probably benign
R5783:Dpp9 UTSW 17 56211655 missense probably damaging 0.98
R6454:Dpp9 UTSW 17 56206808 missense probably damaging 1.00
R6532:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R6894:Dpp9 UTSW 17 56188321 missense probably damaging 1.00
R7398:Dpp9 UTSW 17 56189405 nonsense probably null
R7494:Dpp9 UTSW 17 56200619 missense probably damaging 1.00
R7511:Dpp9 UTSW 17 56205611 missense possibly damaging 0.52
R7556:Dpp9 UTSW 17 56190012 missense possibly damaging 0.66
X0065:Dpp9 UTSW 17 56195006 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGTGTTTTAAGAGGCTAAGAGCTG -3'
(R):5'- ACATTGAGGTTAGCTTGGGC -3'

Sequencing Primer
(F):5'- TGATCAGAGGGAGCAGCCTC -3'
(R):5'- TAGCCAAGGGTGATCTTGAACTCC -3'
Posted On2019-10-17