Incidental Mutation 'R7495:Dpp3'
ID581051
Institutional Source Beutler Lab
Gene Symbol Dpp3
Ensembl Gene ENSMUSG00000063904
Gene Namedipeptidylpeptidase 3
Synonyms4930533O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R7495 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4907229-4928287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4917913 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 316 (E316G)
Ref Sequence ENSEMBL: ENSMUSP00000025851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025851]
Predicted Effect probably damaging
Transcript: ENSMUST00000025851
AA Change: E316G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025851
Gene: ENSMUSG00000063904
AA Change: E316G

DomainStartEndE-ValueType
Pfam:Peptidase_M49 143 704 1.3e-236 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the M49 family of metallopeptidases. This cytoplasmic protein binds a single zinc ion with its zinc-binding motif (HELLGH) and has post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Increased activity of this protein is associated with endometrial and ovarian cancers. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,865,871 E1251G probably damaging Het
Apba1 T C 19: 23,936,599 probably null Het
Arap2 C T 5: 62,676,550 S858N possibly damaging Het
Capn10 T C 1: 92,943,370 F301L probably damaging Het
Catip T C 1: 74,362,692 W9R probably benign Het
Cfap46 A G 7: 139,603,196 probably null Het
Cpq C T 15: 33,302,440 R246C probably damaging Het
Dgkh A G 14: 78,578,799 S1067P probably benign Het
Dpp9 T C 17: 56,195,044 Q508R probably benign Het
Frem2 T C 3: 53,516,837 N3060D probably benign Het
Fstl5 A G 3: 76,707,792 Y720C possibly damaging Het
Gm28168 T C 1: 117,947,907 S89P possibly damaging Het
Hk2 C T 6: 82,727,365 G900E probably damaging Het
Hrh1 A C 6: 114,480,673 D305A probably benign Het
Htt C T 5: 34,811,477 S435L probably benign Het
Ice2 G T 9: 69,416,229 V669L probably benign Het
Klk1b27 G A 7: 44,056,076 V191I probably benign Het
Med12l A G 3: 59,244,773 K993R probably damaging Het
Nfe2l1 A G 11: 96,819,796 Y536H probably damaging Het
Nr4a2 T C 2: 57,112,159 D94G possibly damaging Het
Oit3 T C 10: 59,423,943 D546G possibly damaging Het
Paxbp1 T C 16: 91,016,949 T847A probably damaging Het
Pde12 A T 14: 26,668,839 N238K probably benign Het
Pfkfb3 A C 2: 11,482,501 I366S probably damaging Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Ptprb C A 10: 116,341,448 Q1018K probably benign Het
Rxfp3 C A 15: 11,035,925 G454C probably damaging Het
Scn5a A G 9: 119,543,134 V223A probably damaging Het
Sema4c C A 1: 36,550,693 V527L probably benign Het
Slk C A 19: 47,638,978 P1182T probably damaging Het
Stt3a A G 9: 36,747,939 V368A probably benign Het
Trpm3 T C 19: 22,897,796 F601L probably benign Het
Ttn T C 2: 76,709,955 D34229G probably benign Het
Vmn2r107 A G 17: 20,375,009 H608R possibly damaging Het
Vmn2r49 A T 7: 9,976,899 C635* probably null Het
Zfp473 A T 7: 44,737,944 F95Y probably benign Het
Zfp984 A C 4: 147,754,830 S521R possibly damaging Het
Other mutations in Dpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Dpp3 APN 19 4913892 missense probably benign 0.00
IGL01657:Dpp3 APN 19 4918304 missense possibly damaging 0.72
IGL02105:Dpp3 APN 19 4916771 missense probably damaging 1.00
IGL02251:Dpp3 APN 19 4918315 missense probably benign
IGL02669:Dpp3 APN 19 4923682 critical splice donor site probably null
IGL02739:Dpp3 APN 19 4923728 missense probably damaging 1.00
IGL02851:Dpp3 APN 19 4923131 missense probably benign 0.06
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0046:Dpp3 UTSW 19 4914643 missense probably damaging 0.99
R0053:Dpp3 UTSW 19 4923126 missense probably damaging 0.99
R0505:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R0681:Dpp3 UTSW 19 4914654 missense probably damaging 1.00
R1163:Dpp3 UTSW 19 4914923 nonsense probably null
R1200:Dpp3 UTSW 19 4923129 missense probably benign
R1761:Dpp3 UTSW 19 4921149 missense probably benign 0.37
R1931:Dpp3 UTSW 19 4917860 splice site probably benign
R2255:Dpp3 UTSW 19 4918319 missense probably benign
R2424:Dpp3 UTSW 19 4907707 nonsense probably null
R3718:Dpp3 UTSW 19 4923065 critical splice donor site probably null
R3727:Dpp3 UTSW 19 4923185 missense probably benign 0.30
R5080:Dpp3 UTSW 19 4915080 missense probably benign 0.00
R5587:Dpp3 UTSW 19 4918267 missense probably damaging 0.98
R5786:Dpp3 UTSW 19 4918322 missense possibly damaging 0.53
R5986:Dpp3 UTSW 19 4918357 missense probably benign 0.18
R6128:Dpp3 UTSW 19 4922392 missense probably benign 0.05
R6989:Dpp3 UTSW 19 4921167 missense probably damaging 1.00
R7019:Dpp3 UTSW 19 4916789 missense possibly damaging 0.83
R7070:Dpp3 UTSW 19 4918328 missense probably benign 0.24
R7100:Dpp3 UTSW 19 4918041 missense probably damaging 1.00
R7265:Dpp3 UTSW 19 4923769 missense probably damaging 1.00
R7916:Dpp3 UTSW 19 4917024 nonsense probably null
Z1176:Dpp3 UTSW 19 4922341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCCTGGGACATTAAGTAAG -3'
(R):5'- CAAATGCTGGCTCAGTACGTG -3'

Sequencing Primer
(F):5'- TTAAGTAAGCTGACCCAGGCTGC -3'
(R):5'- CCCATTGTAGAGAGGTGAG -3'
Posted On2019-10-17