Incidental Mutation 'R7495:Apba1'
ID 581053
Institutional Source Beutler Lab
Gene Symbol Apba1
Ensembl Gene ENSMUSG00000024897
Gene Name amyloid beta precursor protein binding family A member 1
Synonyms Lin-10, Mint1, X11, X11alpha, 6430513E09Rik, Mint
MMRRC Submission 045568-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7495 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 23736251-23926960 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 23913963 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025830] [ENSMUST00000025830]
AlphaFold B2RUJ5
Predicted Effect probably null
Transcript: ENSMUST00000025830
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000025830
SMART Domains Protein: ENSMUSP00000025830
Gene: ENSMUSG00000024897

DomainStartEndE-ValueType
low complexity region 40 47 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
low complexity region 129 149 N/A INTRINSIC
low complexity region 404 421 N/A INTRINSIC
PTB 461 626 9.49e-33 SMART
PDZ 670 748 3.09e-15 SMART
PDZ 762 828 2.53e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the X11 protein family. It is a neuronal adapter protein that interacts with the Alzheimer's disease amyloid precursor protein (APP). It stabilizes APP and inhibits production of proteolytic APP fragments including the A beta peptide that is deposited in the brains of Alzheimer's disease patients. This gene product is believed to be involved in signal transduction processes. It is also regarded as a putative vesicular trafficking protein in the brain that can form a complex with the potential to couple synaptic vesicle exocytosis to neuronal cell adhesion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals carrying a homozygous mutation of this gene have reduced body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,915,871 (GRCm39) E1251G probably damaging Het
Arap2 C T 5: 62,833,893 (GRCm39) S858N possibly damaging Het
Capn10 T C 1: 92,871,092 (GRCm39) F301L probably damaging Het
Catip T C 1: 74,401,851 (GRCm39) W9R probably benign Het
Cfap46 A G 7: 139,183,112 (GRCm39) probably null Het
Cpq C T 15: 33,302,586 (GRCm39) R246C probably damaging Het
Dgkh A G 14: 78,816,239 (GRCm39) S1067P probably benign Het
Dpp3 T C 19: 4,967,941 (GRCm39) E316G probably damaging Het
Dpp9 T C 17: 56,502,044 (GRCm39) Q508R probably benign Het
Frem2 T C 3: 53,424,258 (GRCm39) N3060D probably benign Het
Fstl5 A G 3: 76,615,099 (GRCm39) Y720C possibly damaging Het
Gm28168 T C 1: 117,875,637 (GRCm39) S89P possibly damaging Het
Hk2 C T 6: 82,704,346 (GRCm39) G900E probably damaging Het
Hrh1 A C 6: 114,457,634 (GRCm39) D305A probably benign Het
Htt C T 5: 34,968,821 (GRCm39) S435L probably benign Het
Ice2 G T 9: 69,323,511 (GRCm39) V669L probably benign Het
Klk1b27 G A 7: 43,705,500 (GRCm39) V191I probably benign Het
Med12l A G 3: 59,152,194 (GRCm39) K993R probably damaging Het
Nfe2l1 A G 11: 96,710,622 (GRCm39) Y536H probably damaging Het
Nr4a2 T C 2: 57,002,171 (GRCm39) D94G possibly damaging Het
Oit3 T C 10: 59,259,765 (GRCm39) D546G possibly damaging Het
Paxbp1 T C 16: 90,813,837 (GRCm39) T847A probably damaging Het
Pde12 A T 14: 26,389,994 (GRCm39) N238K probably benign Het
Pfkfb3 A C 2: 11,487,312 (GRCm39) I366S probably damaging Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,457,261 (GRCm39) probably benign Het
Ptprb C A 10: 116,177,353 (GRCm39) Q1018K probably benign Het
Rxfp3 C A 15: 11,036,011 (GRCm39) G454C probably damaging Het
Scn5a A G 9: 119,372,200 (GRCm39) V223A probably damaging Het
Sema4c C A 1: 36,589,774 (GRCm39) V527L probably benign Het
Slk C A 19: 47,627,417 (GRCm39) P1182T probably damaging Het
Stt3a A G 9: 36,659,235 (GRCm39) V368A probably benign Het
Trpm3 T C 19: 22,875,160 (GRCm39) F601L probably benign Het
Ttn T C 2: 76,540,299 (GRCm39) D34229G probably benign Het
Vmn2r107 A G 17: 20,595,271 (GRCm39) H608R possibly damaging Het
Vmn2r49 A T 7: 9,710,826 (GRCm39) C635* probably null Het
Zfp473 A T 7: 44,387,368 (GRCm39) F95Y probably benign Het
Zfp984 A C 4: 147,839,287 (GRCm39) S521R possibly damaging Het
Other mutations in Apba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Apba1 APN 19 23,894,950 (GRCm39) missense possibly damaging 0.95
IGL01991:Apba1 APN 19 23,914,836 (GRCm39) missense possibly damaging 0.80
IGL02048:Apba1 APN 19 23,915,000 (GRCm39) splice site probably null
IGL02522:Apba1 APN 19 23,889,809 (GRCm39) splice site probably benign
IGL02728:Apba1 APN 19 23,922,269 (GRCm39) missense possibly damaging 0.93
IGL02942:Apba1 APN 19 23,922,335 (GRCm39) missense possibly damaging 0.78
IGL03349:Apba1 APN 19 23,894,939 (GRCm39) missense probably benign 0.02
IGL03410:Apba1 APN 19 23,914,945 (GRCm39) missense possibly damaging 0.67
R0052:Apba1 UTSW 19 23,893,315 (GRCm39) missense possibly damaging 0.90
R0052:Apba1 UTSW 19 23,893,315 (GRCm39) missense possibly damaging 0.90
R0084:Apba1 UTSW 19 23,889,861 (GRCm39) missense possibly damaging 0.68
R0379:Apba1 UTSW 19 23,912,194 (GRCm39) missense probably damaging 1.00
R0423:Apba1 UTSW 19 23,922,362 (GRCm39) missense probably damaging 1.00
R1132:Apba1 UTSW 19 23,894,917 (GRCm39) missense possibly damaging 0.83
R1291:Apba1 UTSW 19 23,895,036 (GRCm39) missense probably damaging 0.97
R1681:Apba1 UTSW 19 23,913,925 (GRCm39) missense probably damaging 1.00
R1714:Apba1 UTSW 19 23,922,316 (GRCm39) missense possibly damaging 0.67
R1756:Apba1 UTSW 19 23,871,056 (GRCm39) missense possibly damaging 0.83
R1866:Apba1 UTSW 19 23,870,195 (GRCm39) missense probably benign 0.22
R2076:Apba1 UTSW 19 23,870,587 (GRCm39) nonsense probably null
R2217:Apba1 UTSW 19 23,871,326 (GRCm39) missense probably damaging 0.99
R3907:Apba1 UTSW 19 23,914,870 (GRCm39) missense probably damaging 0.96
R4095:Apba1 UTSW 19 23,921,388 (GRCm39) missense probably benign 0.00
R4529:Apba1 UTSW 19 23,913,899 (GRCm39) missense probably damaging 1.00
R4557:Apba1 UTSW 19 23,894,956 (GRCm39) missense probably damaging 1.00
R4972:Apba1 UTSW 19 23,889,900 (GRCm39) missense probably benign 0.24
R5521:Apba1 UTSW 19 23,870,957 (GRCm39) missense probably damaging 1.00
R6539:Apba1 UTSW 19 23,913,924 (GRCm39) missense probably damaging 1.00
R7032:Apba1 UTSW 19 23,889,825 (GRCm39) missense probably benign 0.20
R7035:Apba1 UTSW 19 23,894,931 (GRCm39) missense possibly damaging 0.88
R9149:Apba1 UTSW 19 23,870,782 (GRCm39) missense probably damaging 1.00
R9288:Apba1 UTSW 19 23,923,145 (GRCm39) makesense probably null
Z1176:Apba1 UTSW 19 23,921,479 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGGATTGTCCAGGGTG -3'
(R):5'- GGGGATGCACAGCCTATCATTTATAC -3'

Sequencing Primer
(F):5'- TGCTATAGGCCCAGCTGATC -3'
(R):5'- GTCCTGTGAACACCACTA -3'
Posted On 2019-10-17