Incidental Mutation 'R7496:Sox17'
ID581055
Institutional Source Beutler Lab
Gene Symbol Sox17
Ensembl Gene ENSMUSG00000025902
Gene NameSRY (sex determining region Y)-box 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location4490931-4497354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4492327 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 217 (Y217H)
Ref Sequence ENSEMBL: ENSMUSP00000027035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027035] [ENSMUST00000116652] [ENSMUST00000191647] [ENSMUST00000191939] [ENSMUST00000192650] [ENSMUST00000192913] [ENSMUST00000195555]
PDB Structure Structure of Sox17 Bound to DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027035
AA Change: Y217H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027035
Gene: ENSMUSG00000025902
AA Change: Y217H

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 417 9.5e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116652
AA Change: Y217H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112351
Gene: ENSMUSG00000025902
AA Change: Y217H

DomainStartEndE-ValueType
HMG 67 137 1.57e-28 SMART
low complexity region 182 193 N/A INTRINSIC
Pfam:Sox_C_TAD 197 330 9.8e-19 PFAM
Pfam:Sox_C_TAD 312 418 1.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191647
SMART Domains Protein: ENSMUSP00000142204
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 3.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191939
SMART Domains Protein: ENSMUSP00000142154
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192650
AA Change: Y152H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142116
Gene: ENSMUSG00000025902
AA Change: Y152H

DomainStartEndE-ValueType
Pfam:HMG_box 36 71 2.5e-7 PFAM
low complexity region 117 128 N/A INTRINSIC
Pfam:Sox_C_TAD 132 266 6.1e-16 PFAM
Pfam:Sox_C_TAD 255 353 4.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192913
SMART Domains Protein: ENSMUSP00000141674
Gene: ENSMUSG00000025902

DomainStartEndE-ValueType
HMG 67 137 6.3e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195555
AA Change: Y89H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141894
Gene: ENSMUSG00000025902
AA Change: Y89H

DomainStartEndE-ValueType
SCOP:d2lefa_ 1 21 6e-4 SMART
low complexity region 54 65 N/A INTRINSIC
Pfam:Sox_C_TAD 69 202 4.6e-16 PFAM
Pfam:Sox_C_TAD 192 290 3.1e-27 PFAM
Meta Mutation Damage Score 0.3105 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the Sox (Sry-related high mobility group box) family of transcription factors involved in the regulation of embryonic development. The encoded protein plays a role in the determination of cell fate and in maintaining cell identity. This gene regulates tumor angiogenesis and tumor progression. Mutations in the human gene are associated with vesicoureteral reflux, characterized by the backward flow of urine from the bladder into the ureters or the kidney. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation develop a deficient gut endoderm and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Sox17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sox17 APN 1 4492203 missense possibly damaging 0.66
rheas UTSW 1 4492432 missense possibly damaging 0.71
R1160:Sox17 UTSW 1 4491852 missense probably damaging 1.00
R1503:Sox17 UTSW 1 4491928 missense probably damaging 1.00
R2911:Sox17 UTSW 1 4493131 missense probably damaging 1.00
R3004:Sox17 UTSW 1 4492617 missense probably damaging 1.00
R3508:Sox17 UTSW 1 4492155 missense probably damaging 0.98
R4596:Sox17 UTSW 1 4492637 missense possibly damaging 0.91
R5274:Sox17 UTSW 1 4491888 missense possibly damaging 0.74
R6544:Sox17 UTSW 1 4492432 missense possibly damaging 0.71
R7704:Sox17 UTSW 1 4493672 intron probably benign
R8446:Sox17 UTSW 1 4492093 missense possibly damaging 0.95
R8851:Sox17 UTSW 1 4491850 missense probably benign 0.04
Z1088:Sox17 UTSW 1 4492302 missense probably damaging 1.00
Z1177:Sox17 UTSW 1 4492473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGGATTCCGTGCCATC -3'
(R):5'- CGTTGACCTTGGCAGAGAAG -3'

Sequencing Primer
(F):5'- CCGTAGTACAGGTGCAGAGC -3'
(R):5'- CTTCGTGGAAGAGGCCGAG -3'
Posted On2019-10-17