Incidental Mutation 'R7496:Olfr1246'
ID581060
Institutional Source Beutler Lab
Gene Symbol Olfr1246
Ensembl Gene ENSMUSG00000111715
Gene Nameolfactory receptor 1246
SynonymsGA_x6K02T2Q125-51034790-51033846, MOR231-9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7496 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89586141-89593157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89590696 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 140 (I140V)
Ref Sequence ENSEMBL: ENSMUSP00000150876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187990] [ENSMUST00000213221] [ENSMUST00000217192] [ENSMUST00000217254]
Predicted Effect probably benign
Transcript: ENSMUST00000187990
AA Change: I140V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140066
Gene: ENSMUSG00000111715
AA Change: I140V

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.7e-28 PFAM
Pfam:7tm_4 137 278 3.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213221
AA Change: I140V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000217192
AA Change: I140V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000217254
AA Change: I140V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
BC028528 TGTGGTCACTGGTT TGTGGTCACTGGTTCAGTGGTCACTGGTT 3: 95,888,177 probably benign Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Olfr1246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Olfr1246 APN 2 89590242 missense probably damaging 1.00
IGL02184:Olfr1246 APN 2 89590293 missense probably damaging 0.99
IGL03383:Olfr1246 APN 2 89590312 missense probably benign 0.24
PIT4283001:Olfr1246 UTSW 2 89590228 missense probably benign 0.01
R0453:Olfr1246 UTSW 2 89590751 nonsense probably null
R1614:Olfr1246 UTSW 2 89590696 missense possibly damaging 0.76
R2310:Olfr1246 UTSW 2 89590450 missense probably damaging 0.99
R2436:Olfr1246 UTSW 2 89590773 missense probably benign 0.42
R3683:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R3685:Olfr1246 UTSW 2 89590755 missense probably damaging 0.96
R4037:Olfr1246 UTSW 2 89591035 missense probably benign 0.02
R5219:Olfr1246 UTSW 2 89590702 missense probably benign 0.03
R5350:Olfr1246 UTSW 2 89591088 missense possibly damaging 0.59
R5383:Olfr1246 UTSW 2 89591113 start codon destroyed probably null 0.91
R5639:Olfr1246 UTSW 2 89590725 missense probably damaging 1.00
R5927:Olfr1246 UTSW 2 89591100 missense possibly damaging 0.93
R6056:Olfr1246 UTSW 2 89591101 missense possibly damaging 0.93
R6177:Olfr1246 UTSW 2 89590317 missense possibly damaging 0.78
R7351:Olfr1246 UTSW 2 89590513 missense probably benign 0.32
R7583:Olfr1246 UTSW 2 89590751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGGCAATGAGGGTAAGACC -3'
(R):5'- CCTGCTCATTGTGCTGATGG -3'

Sequencing Primer
(F):5'- CCAATGAAGTAGGTGTCAGTGCAC -3'
(R):5'- CCATCTCACCAAAGTTGATTATGGAC -3'
Posted On2019-10-17