Incidental Mutation 'R7496:Rprd2'
ID581061
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Nameregulation of nuclear pre-mRNA domain containing 2
Synonyms6720469I21Rik, 2810036A19Rik, 4930535B03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95760341-95818863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95765775 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 772 (L772Q)
Ref Sequence ENSEMBL: ENSMUSP00000088297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791]
Predicted Effect probably damaging
Transcript: ENSMUST00000090791
AA Change: L772Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106
AA Change: L772Q

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200164
AA Change: L688Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95765379 missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95765109 missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95785104 missense probably benign 0.05
IGL01022:Rprd2 APN 3 95763754 nonsense probably null
IGL01121:Rprd2 APN 3 95776550 missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95776547 missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95765319 missense probably benign
IGL01414:Rprd2 APN 3 95765525 missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95765503 missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95787310 missense probably benign 0.17
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95774357 missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95766387 missense probably benign 0.30
R0847:Rprd2 UTSW 3 95765413 missense probably benign 0.00
R0942:Rprd2 UTSW 3 95765418 missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95784247 missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95765904 missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95818576 missense possibly damaging 0.57
R1542:Rprd2 UTSW 3 95765676 missense possibly damaging 0.69
R1577:Rprd2 UTSW 3 95764735 missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95818739 unclassified probably benign
R1640:Rprd2 UTSW 3 95763747 unclassified probably benign
R1670:Rprd2 UTSW 3 95764803 missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95764795 nonsense probably null
R2966:Rprd2 UTSW 3 95766433 splice site probably null
R3612:Rprd2 UTSW 3 95764152 missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95764560 missense probably damaging 0.97
R3890:Rprd2 UTSW 3 95765224 missense probably damaging 1.00
R4777:Rprd2 UTSW 3 95787374 missense probably benign 0.41
R4783:Rprd2 UTSW 3 95774333 missense probably benign 0.03
R4832:Rprd2 UTSW 3 95774171 missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95764537 missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95766349 missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5134:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5244:Rprd2 UTSW 3 95790182 missense possibly damaging 0.80
R5314:Rprd2 UTSW 3 95764089 missense possibly damaging 0.53
R5579:Rprd2 UTSW 3 95785059 missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95764863 missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95787373 missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95780441 missense probably damaging 0.99
R6403:Rprd2 UTSW 3 95766087 missense possibly damaging 0.77
R6415:Rprd2 UTSW 3 95774219 missense probably benign 0.00
R7064:Rprd2 UTSW 3 95765016 missense probably damaging 1.00
R7313:Rprd2 UTSW 3 95776710 missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95776587 missense probably damaging 0.96
R8716:Rprd2 UTSW 3 95776793 missense probably damaging 1.00
R8822:Rprd2 UTSW 3 95784301 missense probably damaging 1.00
RF034:Rprd2 UTSW 3 95766320 small deletion probably benign
RF056:Rprd2 UTSW 3 95766319 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGCTTTTCCTGTGAAGAGTC -3'
(R):5'- TCCCGATCCTAAGCAGCTTG -3'

Sequencing Primer
(F):5'- CCTGTGAAGAGTCCATCAGTG -3'
(R):5'- CTAAGCAGCTTGGGATCCAGTG -3'
Posted On2019-10-17