Incidental Mutation 'R7496:Hivep3'
ID581064
Institutional Source Beutler Lab
Gene Symbol Hivep3
Ensembl Gene ENSMUSG00000028634
Gene Namehuman immunodeficiency virus type I enhancer binding protein 3
SynonymsE030045D18Rik, Schnurri-3, Shn3, 2900056N03Rik, Krc
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7496 (G1)
Quality Score187.009
Status Validated
Chromosome4
Chromosomal Location119733784-120138045 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120132402 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2017 (D2017N)
Ref Sequence ENSEMBL: ENSMUSP00000101914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106307] [ENSMUST00000166542]
Predicted Effect probably benign
Transcript: ENSMUST00000106307
AA Change: D2017N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101914
Gene: ENSMUSG00000028634
AA Change: D2017N

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166542
AA Change: D2017N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130249
Gene: ENSMUSG00000028634
AA Change: D2017N

DomainStartEndE-ValueType
ZnF_C2H2 185 207 1.67e-2 SMART
ZnF_C2H2 213 235 8.34e-3 SMART
low complexity region 257 285 N/A INTRINSIC
low complexity region 292 323 N/A INTRINSIC
low complexity region 425 438 N/A INTRINSIC
low complexity region 513 527 N/A INTRINSIC
low complexity region 589 612 N/A INTRINSIC
low complexity region 622 633 N/A INTRINSIC
ZnF_C2H2 636 656 2.06e1 SMART
low complexity region 736 749 N/A INTRINSIC
low complexity region 806 817 N/A INTRINSIC
low complexity region 844 865 N/A INTRINSIC
low complexity region 878 894 N/A INTRINSIC
low complexity region 896 931 N/A INTRINSIC
low complexity region 1010 1020 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1110 1136 N/A INTRINSIC
low complexity region 1143 1167 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1259 1284 N/A INTRINSIC
low complexity region 1376 1390 N/A INTRINSIC
low complexity region 1529 1547 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
ZnF_C2H2 1720 1742 1.82e-3 SMART
ZnF_C2H2 1748 1772 1.69e-3 SMART
low complexity region 1778 1791 N/A INTRINSIC
low complexity region 1814 1843 N/A INTRINSIC
low complexity region 2203 2216 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the human immunodeficiency virus type 1 enhancer-binding protein family. Members of this protein family contain multiple zinc finger and acid-rich (ZAS) domains and serine-threonine rich regions. This protein acts as a transcription factor and is able to regulate nuclear factor kappaB-mediated transcription by binding the kappaB motif in target genes. This protein also binds the recombination signal sequence that flanks the V, D, and J regions of immunoglobulin and T-cell receptors. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mutation of this gene results in diminished IL-2 production by stimulated CD4 cells. Mice homozygous for a knock-out allele exhibit increased bone volume. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Hivep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Hivep3 APN 4 120098374 missense probably damaging 1.00
IGL01017:Hivep3 APN 4 120099246 missense probably damaging 0.98
IGL01837:Hivep3 APN 4 120094562 missense possibly damaging 0.72
IGL01878:Hivep3 APN 4 120095227 missense possibly damaging 0.84
IGL02134:Hivep3 APN 4 120133574 splice site probably benign
IGL02183:Hivep3 APN 4 120132024 missense probably benign 0.04
IGL02350:Hivep3 APN 4 120123025 missense probably damaging 1.00
IGL02451:Hivep3 APN 4 120133965 missense probably damaging 1.00
IGL02567:Hivep3 APN 4 120133956 missense probably damaging 0.99
IGL02617:Hivep3 APN 4 120095444 missense probably benign 0.04
IGL02725:Hivep3 APN 4 120095822 missense possibly damaging 0.48
IGL02828:Hivep3 APN 4 120097732 nonsense probably null
IGL02954:Hivep3 APN 4 120133641 missense probably damaging 1.00
IGL02966:Hivep3 APN 4 120132186 missense probably benign 0.04
Deceit UTSW 4 120097911 frame shift probably null
Stealth UTSW 4 120122876 nonsense probably null
PIT4260001:Hivep3 UTSW 4 120099182 missense probably damaging 1.00
R0321:Hivep3 UTSW 4 120095591 missense possibly damaging 0.84
R0336:Hivep3 UTSW 4 120103847 missense probably damaging 1.00
R0558:Hivep3 UTSW 4 120096566 missense probably damaging 0.98
R0562:Hivep3 UTSW 4 120096554 missense probably benign 0.00
R0637:Hivep3 UTSW 4 120132541 nonsense probably null
R0645:Hivep3 UTSW 4 120097334 missense possibly damaging 0.95
R1186:Hivep3 UTSW 4 119814723 start gained probably benign
R1254:Hivep3 UTSW 4 120099293 missense probably damaging 1.00
R1428:Hivep3 UTSW 4 120096575 missense possibly damaging 0.92
R1623:Hivep3 UTSW 4 120095704 missense possibly damaging 0.84
R1739:Hivep3 UTSW 4 120095174 missense probably benign 0.03
R1766:Hivep3 UTSW 4 120096671 missense probably benign
R1769:Hivep3 UTSW 4 120097571 missense possibly damaging 0.68
R1773:Hivep3 UTSW 4 120098837 missense probably damaging 1.00
R1968:Hivep3 UTSW 4 120096238 missense possibly damaging 0.83
R2220:Hivep3 UTSW 4 119734038 missense possibly damaging 0.92
R2428:Hivep3 UTSW 4 120098508 nonsense probably null
R3789:Hivep3 UTSW 4 120098416 missense probably damaging 1.00
R3917:Hivep3 UTSW 4 120099427 missense probably benign 0.27
R4366:Hivep3 UTSW 4 120096089 missense possibly damaging 0.84
R4436:Hivep3 UTSW 4 120095923 missense probably benign 0.11
R4504:Hivep3 UTSW 4 119733793 unclassified probably benign
R4705:Hivep3 UTSW 4 119872050 intron probably benign
R4713:Hivep3 UTSW 4 120131803 missense probably damaging 1.00
R4756:Hivep3 UTSW 4 120097823 missense probably damaging 0.98
R4887:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R4888:Hivep3 UTSW 4 120122934 missense probably damaging 1.00
R5008:Hivep3 UTSW 4 120098917 missense probably benign 0.22
R5204:Hivep3 UTSW 4 120103856 critical splice donor site probably null
R5594:Hivep3 UTSW 4 120123048 critical splice donor site probably null
R5697:Hivep3 UTSW 4 120096955 missense possibly damaging 0.68
R5715:Hivep3 UTSW 4 120096373 missense probably benign
R5740:Hivep3 UTSW 4 120096023 missense possibly damaging 0.83
R5760:Hivep3 UTSW 4 120095011 missense possibly damaging 0.83
R5923:Hivep3 UTSW 4 120096293 missense possibly damaging 0.92
R5927:Hivep3 UTSW 4 120097108 missense possibly damaging 0.68
R6042:Hivep3 UTSW 4 120097864 missense possibly damaging 0.85
R6074:Hivep3 UTSW 4 120097694 missense possibly damaging 0.68
R6150:Hivep3 UTSW 4 119734077 nonsense probably null
R6211:Hivep3 UTSW 4 120098405 missense probably damaging 1.00
R6251:Hivep3 UTSW 4 120094940 missense probably damaging 0.98
R6451:Hivep3 UTSW 4 120098908 missense probably benign 0.22
R6531:Hivep3 UTSW 4 120122876 nonsense probably null
R6651:Hivep3 UTSW 4 120122949 missense probably damaging 1.00
R6701:Hivep3 UTSW 4 120094540 missense probably damaging 0.97
R6721:Hivep3 UTSW 4 120095099 missense possibly damaging 0.82
R6796:Hivep3 UTSW 4 120096361 missense possibly damaging 0.68
R6864:Hivep3 UTSW 4 120094888 missense possibly damaging 0.48
R6902:Hivep3 UTSW 4 120095995 missense possibly damaging 0.48
R7111:Hivep3 UTSW 4 120095234 missense possibly damaging 0.68
R7113:Hivep3 UTSW 4 120098369 missense probably damaging 1.00
R7140:Hivep3 UTSW 4 120097121 missense probably damaging 0.99
R7189:Hivep3 UTSW 4 120132219 missense probably damaging 0.99
R7218:Hivep3 UTSW 4 120095452 missense possibly damaging 0.92
R7366:Hivep3 UTSW 4 120097911 frame shift probably null
R7368:Hivep3 UTSW 4 120097911 frame shift probably null
R7491:Hivep3 UTSW 4 120098830 missense probably benign 0.09
R7514:Hivep3 UTSW 4 120096855 missense possibly damaging 0.48
R7604:Hivep3 UTSW 4 120097911 frame shift probably null
R7605:Hivep3 UTSW 4 120097911 frame shift probably null
R7607:Hivep3 UTSW 4 120097911 frame shift probably null
R7610:Hivep3 UTSW 4 120097911 frame shift probably null
R7611:Hivep3 UTSW 4 120097911 frame shift probably null
R7613:Hivep3 UTSW 4 120097911 frame shift probably null
R7626:Hivep3 UTSW 4 120097911 frame shift probably null
R7707:Hivep3 UTSW 4 119733959 missense
R7736:Hivep3 UTSW 4 120095543 missense possibly damaging 0.92
RF019:Hivep3 UTSW 4 120098270 missense probably benign 0.12
X0062:Hivep3 UTSW 4 120098698 missense probably damaging 1.00
X0067:Hivep3 UTSW 4 120131787 missense probably damaging 0.96
Z1176:Hivep3 UTSW 4 120133782 missense probably damaging 1.00
Z1177:Hivep3 UTSW 4 120095946 missense possibly damaging 0.68
Z1177:Hivep3 UTSW 4 120131778 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTCCCCAGCAATGTTCAC -3'
(R):5'- GTGAATGGGCAGCTTCTGAC -3'

Sequencing Primer
(F):5'- AATGTTCACCGGCCCGAGAAG -3'
(R):5'- ACTCACCCATGCAGAGGTG -3'
Posted On2019-10-17