Incidental Mutation 'R7496:Zfp932'
ID581067
Institutional Source Beutler Lab
Gene Symbol Zfp932
Ensembl Gene ENSMUSG00000066613
Gene Namezinc finger protein 932
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7496 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109996521-110010411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 110008828 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 131 (P131S)
Ref Sequence ENSEMBL: ENSMUSP00000108159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099484] [ENSMUST00000112536] [ENSMUST00000112540] [ENSMUST00000125213] [ENSMUST00000143639] [ENSMUST00000187241]
Predicted Effect probably benign
Transcript: ENSMUST00000099484
SMART Domains Protein: ENSMUSP00000097083
Gene: ENSMUSG00000066613

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112536
AA Change: P98S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108155
Gene: ENSMUSG00000066613
AA Change: P98S

DomainStartEndE-ValueType
Blast:KRAB 1 31 5e-12 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
ZnF_C2H2 183 205 1.3e-4 SMART
ZnF_C2H2 211 233 1.1e-2 SMART
ZnF_C2H2 239 261 2.27e-4 SMART
ZnF_C2H2 267 289 1.84e-4 SMART
ZnF_C2H2 295 317 5.21e-4 SMART
ZnF_C2H2 323 345 9.73e-4 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 1.58e-3 SMART
ZnF_C2H2 407 429 5.14e-3 SMART
ZnF_C2H2 435 457 2.61e-4 SMART
ZnF_C2H2 463 485 2.43e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112540
AA Change: P131S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108159
Gene: ENSMUSG00000066613
AA Change: P131S

DomainStartEndE-ValueType
KRAB 5 61 1.74e-14 SMART
ZnF_C2H2 104 126 1.1e-2 SMART
ZnF_C2H2 132 154 5.21e-4 SMART
ZnF_C2H2 160 182 3.39e-3 SMART
ZnF_C2H2 188 210 1.76e-1 SMART
ZnF_C2H2 216 238 1.3e-4 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.27e-4 SMART
ZnF_C2H2 300 322 1.84e-4 SMART
ZnF_C2H2 328 350 5.21e-4 SMART
ZnF_C2H2 356 378 9.73e-4 SMART
ZnF_C2H2 384 406 1.58e-3 SMART
ZnF_C2H2 412 434 1.58e-3 SMART
ZnF_C2H2 440 462 5.14e-3 SMART
ZnF_C2H2 468 490 2.61e-4 SMART
ZnF_C2H2 496 518 2.43e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125213
AA Change: P98S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119843
Gene: ENSMUSG00000066613
AA Change: P98S

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-14 BLAST
ZnF_C2H2 71 93 1.1e-2 SMART
ZnF_C2H2 99 121 5.21e-4 SMART
ZnF_C2H2 127 149 3.39e-3 SMART
ZnF_C2H2 155 177 1.76e-1 SMART
Pfam:zf-C2H2_6 182 191 7.3e-1 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000143639
AA Change: P130S

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121749
Gene: ENSMUSG00000066613
AA Change: P130S

DomainStartEndE-ValueType
KRAB 4 60 1.74e-14 SMART
ZnF_C2H2 103 125 1.1e-2 SMART
ZnF_C2H2 131 153 5.21e-4 SMART
ZnF_C2H2 159 181 3.39e-3 SMART
ZnF_C2H2 187 209 1.76e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187241
AA Change: P131S

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140446
Gene: ENSMUSG00000066613
AA Change: P131S

DomainStartEndE-ValueType
KRAB 5 61 7.1e-17 SMART
ZnF_C2H2 104 126 4.8e-5 SMART
ZnF_C2H2 132 154 2.2e-6 SMART
ZnF_C2H2 160 182 1.5e-5 SMART
ZnF_C2H2 188 210 7.2e-4 SMART
ZnF_C2H2 216 238 5.4e-7 SMART
ZnF_C2H2 244 266 4.5e-5 SMART
ZnF_C2H2 272 294 9.2e-7 SMART
ZnF_C2H2 300 322 7.5e-7 SMART
ZnF_C2H2 328 350 2.1e-6 SMART
ZnF_C2H2 356 378 4e-6 SMART
ZnF_C2H2 384 406 6.5e-6 SMART
ZnF_C2H2 412 434 6.9e-6 SMART
ZnF_C2H2 440 462 2.1e-5 SMART
ZnF_C2H2 468 490 1.1e-6 SMART
ZnF_C2H2 496 518 1.1e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bcl2l14 A G 6: 134,427,454 N202D probably benign Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Other mutations in Zfp932
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Zfp932 UTSW 5 110006968 missense probably benign 0.27
R0268:Zfp932 UTSW 5 110009063 missense probably benign 0.24
R1673:Zfp932 UTSW 5 110008988 missense probably damaging 1.00
R1797:Zfp932 UTSW 5 109996623 start gained probably benign
R1893:Zfp932 UTSW 5 110009203 missense possibly damaging 0.71
R1942:Zfp932 UTSW 5 110006987 missense probably damaging 1.00
R2073:Zfp932 UTSW 5 110009818 missense possibly damaging 0.60
R2076:Zfp932 UTSW 5 110009468 missense probably benign 0.01
R2329:Zfp932 UTSW 5 110009540 missense probably benign 0.01
R3944:Zfp932 UTSW 5 110009954 missense probably benign 0.37
R4551:Zfp932 UTSW 5 110009639 missense probably benign 0.03
R4679:Zfp932 UTSW 5 110009894 missense probably damaging 1.00
R4692:Zfp932 UTSW 5 110009186 missense probably damaging 1.00
R5116:Zfp932 UTSW 5 110009376 missense probably benign 0.05
R5260:Zfp932 UTSW 5 110009635 nonsense probably null
R5536:Zfp932 UTSW 5 110009847 nonsense probably null
R6351:Zfp932 UTSW 5 110009343 nonsense probably null
R6786:Zfp932 UTSW 5 110009740 missense probably damaging 0.98
R6843:Zfp932 UTSW 5 110008715 missense probably benign 0.02
R7437:Zfp932 UTSW 5 110010014 missense probably benign 0.10
R7704:Zfp932 UTSW 5 110009764 missense probably benign 0.09
R8224:Zfp932 UTSW 5 109996614 start gained probably benign
R8317:Zfp932 UTSW 5 110009056 nonsense probably null
R8765:Zfp932 UTSW 5 110006961 missense probably benign 0.01
R8967:Zfp932 UTSW 5 110009017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTTGCAGGCATGAAAGAAAT -3'
(R):5'- TGTGTACGGAGACTGGCATTAC -3'

Sequencing Primer
(F):5'- TCATACTGGAGAGAAACCCTACG -3'
(R):5'- GTGCAAAGGCTTTACTACACTG -3'
Posted On2019-10-17