Incidental Mutation 'R7496:Bcl2l14'
ID581069
Institutional Source Beutler Lab
Gene Symbol Bcl2l14
Ensembl Gene ENSMUSG00000030200
Gene NameBCL2-like 14 (apoptosis facilitator)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7496 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location134396318-134438736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134427454 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 202 (N202D)
Ref Sequence ENSEMBL: ENSMUSP00000032321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032321] [ENSMUST00000111960] [ENSMUST00000127865] [ENSMUST00000163589]
Predicted Effect probably benign
Transcript: ENSMUST00000032321
AA Change: N202D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000032321
Gene: ENSMUSG00000030200
AA Change: N202D

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111960
AA Change: N202D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107591
Gene: ENSMUSG00000030200
AA Change: N202D

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127865
SMART Domains Protein: ENSMUSP00000115608
Gene: ENSMUSG00000030200

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163589
AA Change: N202D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000132525
Gene: ENSMUSG00000030200
AA Change: N202D

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,732,857 I626V probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Ago1 C T 4: 126,461,752 R88H probably benign Het
Ankrd6 C T 4: 32,810,299 D461N probably damaging Het
Bnip2 A G 9: 70,003,404 I245V probably damaging Het
Cdhr3 T C 12: 33,060,265 D340G probably damaging Het
Dchs1 T C 7: 105,761,859 E1653G probably damaging Het
Dhdds C A 4: 133,971,254 Q256H possibly damaging Het
Dsc2 A T 18: 20,035,394 C669* probably null Het
Dync2h1 T C 9: 7,135,015 probably null Het
Dysf T C 6: 84,067,478 S276P probably benign Het
Galc A T 12: 98,259,238 L31* probably null Het
Gm527 C T 12: 64,922,410 R204C possibly damaging Het
Hivep3 G A 4: 120,132,402 D2017N probably benign Het
Inf2 C T 12: 112,600,318 R106C probably damaging Het
Itgb1 A G 8: 128,720,305 K434E probably benign Het
Lamb1 A C 12: 31,300,021 N700T probably benign Het
Macc1 T G 12: 119,446,999 F501V possibly damaging Het
Man2a2 G A 7: 80,352,997 H1079Y probably damaging Het
Nedd4l G A 18: 65,080,018 V82I possibly damaging Het
Nr2f1 T C 13: 78,195,242 E301G probably damaging Het
Olfr1129 A G 2: 87,575,371 R96G probably damaging Het
Olfr1246 T C 2: 89,590,696 I140V probably benign Het
Olfr695 A G 7: 106,714,228 L151P probably benign Het
Pdgfrb G A 18: 61,078,932 V844I possibly damaging Het
Pkd1l2 T C 8: 117,060,594 E570G possibly damaging Het
R3hdm4 A T 10: 79,916,874 L4Q probably damaging Het
Rb1cc1 A G 1: 6,248,191 K639R probably null Het
Robo3 A T 9: 37,427,825 C257S probably damaging Het
Rprd2 A T 3: 95,765,775 L772Q probably damaging Het
Sall2 T C 14: 52,315,561 D59G possibly damaging Het
Sall3 T C 18: 80,973,364 T450A probably benign Het
Sdhd T C 9: 50,597,085 *160W probably null Het
Sgca T C 11: 94,971,244 E194G possibly damaging Het
Shtn1 G A 19: 59,028,184 R228C probably damaging Het
Skor1 A T 9: 63,146,850 S22T probably benign Het
Slc26a8 C A 17: 28,644,850 G645V probably benign Het
Smtn T C 11: 3,529,988 E411G probably damaging Het
Sox17 A G 1: 4,492,327 Y217H probably damaging Het
Syk A G 13: 52,612,416 Q179R probably benign Het
Tpp2 A G 1: 43,983,517 I959M probably benign Het
Trim65 T A 11: 116,126,316 N440I probably damaging Het
Ubr2 C T 17: 46,990,991 probably null Het
Ush2a T C 1: 188,351,087 S276P possibly damaging Het
Vmn1r61 A G 7: 5,610,431 S295P probably benign Het
Wdhd1 T C 14: 47,274,024 Q77R probably benign Het
Xylb T A 9: 119,391,816 *552R probably null Het
Zfp932 C T 5: 110,008,828 P131S probably damaging Het
Other mutations in Bcl2l14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Bcl2l14 APN 6 134423865 missense probably damaging 1.00
IGL02451:Bcl2l14 APN 6 134423841 missense probably benign 0.18
R1115:Bcl2l14 UTSW 6 134432139 splice site probably benign
R1482:Bcl2l14 UTSW 6 134427302 missense probably damaging 1.00
R1952:Bcl2l14 UTSW 6 134432366 missense probably damaging 1.00
R3932:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R3933:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R5772:Bcl2l14 UTSW 6 134427399 missense probably damaging 0.98
R6295:Bcl2l14 UTSW 6 134427407 missense probably benign 0.40
R7078:Bcl2l14 UTSW 6 134423823 missense probably damaging 0.98
R7785:Bcl2l14 UTSW 6 134432260 missense possibly damaging 0.96
R7792:Bcl2l14 UTSW 6 134432314 missense possibly damaging 0.84
R7949:Bcl2l14 UTSW 6 134430120 missense probably damaging 1.00
R8474:Bcl2l14 UTSW 6 134423757 missense probably benign 0.07
R8907:Bcl2l14 UTSW 6 134423622 missense probably damaging 1.00
X0062:Bcl2l14 UTSW 6 134427371 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTGCATCCCCAGTTCTG -3'
(R):5'- CAACAAGCTAATGGCATTCCTG -3'

Sequencing Primer
(F):5'- GGCCTCTGAGCAGTGCTTTC -3'
(R):5'- CAAGCTAATGGCATTCCTGTGTCTTG -3'
Posted On2019-10-17