Incidental Mutation 'R7496:Man2a2'
ID 581071
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms MX, alpha mannosidase IIx, 1700052O22Rik, 4931438M07Rik
MMRRC Submission 045569-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.231) question?
Stock # R7496 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79998845-80021123 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80002745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 1079 (H1079Y)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000206089] [ENSMUST00000206807]
AlphaFold Q8BRK9
Predicted Effect probably damaging
Transcript: ENSMUST00000098346
AA Change: H1079Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: H1079Y

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206089
Predicted Effect probably benign
Transcript: ENSMUST00000206807
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 T C 16: 56,553,220 (GRCm39) I626V probably benign Het
Adgrv1 A T 13: 81,588,344 (GRCm39) V4414E possibly damaging Het
Ago1 C T 4: 126,355,545 (GRCm39) R88H probably benign Het
Ankrd6 C T 4: 32,810,299 (GRCm39) D461N probably damaging Het
Bcl2l14 A G 6: 134,404,417 (GRCm39) N202D probably benign Het
Bnip2 A G 9: 69,910,686 (GRCm39) I245V probably damaging Het
Cdhr3 T C 12: 33,110,264 (GRCm39) D340G probably damaging Het
Dchs1 T C 7: 105,411,066 (GRCm39) E1653G probably damaging Het
Dhdds C A 4: 133,698,565 (GRCm39) Q256H possibly damaging Het
Dsc2 A T 18: 20,168,451 (GRCm39) C669* probably null Het
Dync2h1 T C 9: 7,135,015 (GRCm39) probably null Het
Dysf T C 6: 84,044,460 (GRCm39) S276P probably benign Het
Galc A T 12: 98,225,497 (GRCm39) L31* probably null Het
Gm527 C T 12: 64,969,184 (GRCm39) R204C possibly damaging Het
Hivep3 G A 4: 119,989,599 (GRCm39) D2017N probably benign Het
Inf2 C T 12: 112,566,752 (GRCm39) R106C probably damaging Het
Itgb1 A G 8: 129,446,786 (GRCm39) K434E probably benign Het
Lamb1 A C 12: 31,350,020 (GRCm39) N700T probably benign Het
Macc1 T G 12: 119,410,734 (GRCm39) F501V possibly damaging Het
Nedd4l G A 18: 65,213,089 (GRCm39) V82I possibly damaging Het
Nr2f1 T C 13: 78,343,361 (GRCm39) E301G probably damaging Het
Or10ag59 A G 2: 87,405,715 (GRCm39) R96G probably damaging Het
Or2ag13 A G 7: 106,313,435 (GRCm39) L151P probably benign Het
Or4a73 T C 2: 89,421,040 (GRCm39) I140V probably benign Het
Pdgfrb G A 18: 61,212,004 (GRCm39) V844I possibly damaging Het
Pkd1l2 T C 8: 117,787,333 (GRCm39) E570G possibly damaging Het
R3hdm4 A T 10: 79,752,708 (GRCm39) L4Q probably damaging Het
Rb1cc1 A G 1: 6,318,415 (GRCm39) K639R probably null Het
Robo3 A T 9: 37,339,121 (GRCm39) C257S probably damaging Het
Rprd2 A T 3: 95,673,087 (GRCm39) L772Q probably damaging Het
Sall2 T C 14: 52,553,018 (GRCm39) D59G possibly damaging Het
Sall3 T C 18: 81,016,579 (GRCm39) T450A probably benign Het
Sdhd T C 9: 50,508,385 (GRCm39) *160W probably null Het
Sgca T C 11: 94,862,070 (GRCm39) E194G possibly damaging Het
Shtn1 G A 19: 59,016,616 (GRCm39) R228C probably damaging Het
Skor1 A T 9: 63,054,132 (GRCm39) S22T probably benign Het
Slc26a8 C A 17: 28,863,824 (GRCm39) G645V probably benign Het
Smtn T C 11: 3,479,988 (GRCm39) E411G probably damaging Het
Sox17 A G 1: 4,562,550 (GRCm39) Y217H probably damaging Het
Syk A G 13: 52,766,452 (GRCm39) Q179R probably benign Het
Tpp2 A G 1: 44,022,677 (GRCm39) I959M probably benign Het
Trim65 T A 11: 116,017,142 (GRCm39) N440I probably damaging Het
Ubr2 C T 17: 47,301,917 (GRCm39) probably null Het
Ush2a T C 1: 188,083,284 (GRCm39) S276P possibly damaging Het
Vmn1r61 A G 7: 5,613,430 (GRCm39) S295P probably benign Het
Wdhd1 T C 14: 47,511,481 (GRCm39) Q77R probably benign Het
Xylb T A 9: 119,220,882 (GRCm39) *552R probably null Het
Zfp932 C T 5: 110,156,694 (GRCm39) P131S probably damaging Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80,010,880 (GRCm39) missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80,010,682 (GRCm39) missense probably benign 0.00
IGL01717:Man2a2 APN 7 80,017,113 (GRCm39) missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80,012,654 (GRCm39) missense probably benign
IGL02212:Man2a2 APN 7 80,012,056 (GRCm39) missense probably benign 0.00
IGL02383:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80,019,363 (GRCm39) missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80,009,388 (GRCm39) missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80,013,689 (GRCm39) missense probably benign 0.00
IGL03084:Man2a2 APN 7 80,002,691 (GRCm39) missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80,009,082 (GRCm39) missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80,008,800 (GRCm39) splice site probably null
IGL03412:Man2a2 APN 7 80,016,746 (GRCm39) missense probably damaging 1.00
dugong UTSW 7 80,010,669 (GRCm39) missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80,013,858 (GRCm39) unclassified probably benign
R7828_Man2a2_437 UTSW 7 80,016,674 (GRCm39) missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80,008,024 (GRCm39) missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80,017,153 (GRCm39) missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80,012,945 (GRCm39) missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80,012,713 (GRCm39) missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80,018,310 (GRCm39) missense probably benign 0.06
R1626:Man2a2 UTSW 7 80,017,450 (GRCm39) missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80,012,186 (GRCm39) missense probably benign 0.10
R1820:Man2a2 UTSW 7 80,008,681 (GRCm39) missense probably benign 0.22
R2090:Man2a2 UTSW 7 80,013,858 (GRCm39) unclassified probably benign
R2144:Man2a2 UTSW 7 80,013,264 (GRCm39) missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80,017,532 (GRCm39) missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80,012,063 (GRCm39) missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80,001,487 (GRCm39) missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80,018,367 (GRCm39) missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80,001,487 (GRCm39) missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80,001,463 (GRCm39) missense probably benign 0.37
R4494:Man2a2 UTSW 7 80,009,023 (GRCm39) splice site probably null
R4564:Man2a2 UTSW 7 80,018,586 (GRCm39) missense probably benign 0.00
R4631:Man2a2 UTSW 7 80,012,211 (GRCm39) missense probably benign 0.10
R5328:Man2a2 UTSW 7 80,018,504 (GRCm39) missense probably benign 0.06
R5329:Man2a2 UTSW 7 80,010,876 (GRCm39) missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80,002,729 (GRCm39) missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80,018,106 (GRCm39) missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80,002,780 (GRCm39) missense probably benign 0.00
R5915:Man2a2 UTSW 7 80,010,669 (GRCm39) missense probably benign 0.12
R5937:Man2a2 UTSW 7 80,013,251 (GRCm39) missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80,016,749 (GRCm39) missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80,016,749 (GRCm39) missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80,013,819 (GRCm39) missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80,002,947 (GRCm39) missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80,012,693 (GRCm39) missense probably benign 0.35
R6918:Man2a2 UTSW 7 80,002,940 (GRCm39) missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80,009,499 (GRCm39) missense probably benign 0.19
R7236:Man2a2 UTSW 7 80,018,653 (GRCm39) missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7523:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7524:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7583:Man2a2 UTSW 7 80,016,692 (GRCm39) missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80,001,497 (GRCm39) missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80,016,674 (GRCm39) missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7845:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7847:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7848:Man2a2 UTSW 7 80,018,613 (GRCm39) missense probably benign 0.00
R7984:Man2a2 UTSW 7 80,003,056 (GRCm39) missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80,010,766 (GRCm39) missense probably benign
R8296:Man2a2 UTSW 7 80,018,656 (GRCm39) missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80,010,671 (GRCm39) nonsense probably null
R8515:Man2a2 UTSW 7 80,018,038 (GRCm39) missense possibly damaging 0.88
R8842:Man2a2 UTSW 7 80,003,067 (GRCm39) missense probably damaging 1.00
R9205:Man2a2 UTSW 7 80,010,868 (GRCm39) missense probably benign
R9563:Man2a2 UTSW 7 80,006,101 (GRCm39) missense probably benign
X0057:Man2a2 UTSW 7 80,012,072 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTGAAATGGCTCCTGC -3'
(R):5'- ATTTGCTCAATCTGCGCATG -3'

Sequencing Primer
(F):5'- TTAGTCTCCAGAGAGCCCC -3'
(R):5'- AATCTGCGCATGCTCCCAG -3'
Posted On 2019-10-17